AGPAT2 (NM_001012727) Human 3' UTR Clone

CAT#: SC208346

3`UTR clone of 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase beta) (AGPAT2) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AGPAT2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AGPAT2
Synonyms 1-AGPAT2; BSCL; BSCL1; LPAAB; LPAAT-beta
ACCN NM_001012727
Insert Size 605
Sequence Data
>SC208346 3'UTR clone of NM_001012727
The sequence shown below is from the reference sequence of NM_001012727. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTCTGGCGTGCAGCCGGCCCAGTAGCCCAGACCACGGCAGGGCATGACCTGGGGAGGGCAGGTGGAAGC
CGATGGCTGGAGGATGGGCAGAGGGGACTCCTCCCGGCTTCCAAATACCACTCTGTCCGGCTCCCCCAGC
TCTCACTCAGCCCGGGAAGCAGGAAGCCCCTTCTGTCACTGGCCTCAGACACAGGCCCCTGGTGTCCCCT
GCAGGGGGCTCAGCTGGACCCTCCCCGGGCTCGAGGGCAGGGACTCGCGCCCACGGCACCTCTGGGAGCT
GGGATGATAAAGATGAGGCTTGCGGCTGTGGCCCGCTGGTGGGCTGAGCCACAAGGCCCCCGATGGCCCA
GGAGCAGATGGGAGGACCCCGAGGCCAGACGCACACTGTCCGAGCCCTCTGCTCAGCCGCCTGGGACCCA
CCAGGGTGCAGCTGGGCTCCAGGGTCCAGCCCACAAGCTGCATCAGGCTCTCTGGGAGAGGAGGGGCCTG
GAGGGCCAGGAGTCCCAGACTCACGCACCCTGGGCCACAGGGAGCCGGGAATCGGGGCCTGCTGCTCCTG
CTGGCCTGGAAGACTCTGTGGGGTCAGCACTGTACTCCGTTGCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001012727.1
Summary This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 10555

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.