HEXA (NM_000520) Human 3' UTR Clone

CAT#: SC208386

3`UTR clone of hexosaminidase A (alpha polypeptide) (HEXA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HEXA
• Synonyms: TSD
• ACCN: NM_000520
• Insert Size: 676 bp
• Sequence Data:
  Insert Sequence

  >SC208386 3'UTR clone of NM_000520
  The sequence shown below is from the reference sequence of NM_000520. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTAGGCTTCTGTGAGCAGGAGTTTGAACAGACCTGAGCCCCAGGCACCGAGGAGGGTGCTGGCTGTAGG
  TGAATGGTAGTGGAGCCAGGCTTCCACTGCATCCTGGCCAGGGGACGGAGCCCCTTGCCTTCGTGCCCCT
  TGCCTGCGTGCCCCTGTGCTTGGAGAGAAAGGGGCCGGTGCTGGCGCTCGCATTCAATAAAGAGTAATGT
  GGCATTTTTCTATAATAAACATGGATTACCTGTGTTTAAAAAAAAAAGTGTGAATGGCGTTAGGGTAAGG
  GCACAGCCAGGCTGGAGTCAGTGTCTGCCCCTGAGGTCTTTTAAGTTGAGGGCTGGGAATGAAACCTATA
  GCCTTTGTGCTGTTCTGCCTTGCCTGTGAGCTATGTCACTCCCCTCCCACTCCTGACCATATTCCAGACA
  CCTGCCCTAATCCTCAGCCTGCTCACTTCACTTCTGCATTATATCTCCAAGGCGTTGGTATATGGAAAAA
  GATGTAGGGGCTTGGAGGTGTTCTGGACAGTGGGGAGGGCTCCAGACCCAACCTGGTCACAGAAGAGCCT
  CTCCCCCATGCATACTCATCCACCTCCCTCCCCTAGAGCTATTCTCCTTTGGGTTTCTTGCTGCTTCAAT
  TTTATACAACCATTATTTAAATATTATTAAACACATATTGTTCTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000520.4
• Summary: 'This gene encodes a member of the glycosyl hydrolase 20 family of proteins. The encoded preproprotein is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase. This enzyme, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mutations in this gene lead to an accumulation of GM2 ganglioside in neurons, the underlying cause of neurodegenerative disorders termed the GM2 gangliosidoses, including Tay-Sachs disease (GM2-gangliosidosis type I). Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]'
• Locus ID: 3073