CAMKIV (CAMK4) (NM_001744) Human 3' UTR Clone

CAT#: SC208447

3`UTR clone of calcium/calmodulin-dependent protein kinase IV (CAMK4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CAMK4
• Synonyms: caMK; CaMK-GR; CaMK IV; CaMKIV
• ACCN: NM_001744
• Insert Size: 610 bp
• Sequence Data:
  Insert Sequence

  >SC208447 3'UTR clone of NM_001744
  The sequence shown below is from the reference sequence of NM_001744. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCAAGATGTGATCCTGCCAGAGTACTAAACAGCTTCCTTCAGATCTGGAAGCCAAACACCGGCATTTT
  ATGTACTTTGTCCTTCAGCAAGAAAGGTGTGGAAGCATGATATGTACTATAGTGATTCTGTTTTTGAGGT
  GCAAAAAACATACATATATACCAGTTGGTAATTCTAACTTCAATGCATGTGACTGCTTTATGAAAATAAT
  AGTGTCTTCTATGGCATGTAATGGATACCTAATACCGATGAGTTAAATCTTGCAAGTTAACACAACGTAA
  CACTTAAAAGCATACATTTTCAGCAACCAGTGGCACATATTTGAAGTGAATAGTAGCAAATTGTTTTTGC
  TTTGAAAATCTAGCCATCCTACATCCTTTGGATTTCTTCACAAGGCAGTAATTCCTTTGAACTACTGCTT
  AGCTAATACTAGGTAGTGCTAAAAGACATGTTCCCATAACTTTTACAACATTTTACTTTTTATCATTGAT
  GTGTTCAAACTGTTTACAAGGAGATGCTTATAGATGATAGTTGTACATATGTGCAAAAAAAAATCCACTT
  GCAATGGTAAGAAATTGAAGTATCCTTAAAGGCCATGAAGCCATATGTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001744.3
• Summary: 'The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]'
• Locus ID: 814