Tenascin C (TNC) (NM_002160) Human 3' UTR Clone

CAT#: SC208471

3`UTR clone of tenascin C (TNC) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TNC
Synonyms 150-225; DFNA56; GMEM; GP; HXB; JI; TN; TN-C
ACCN NM_002160
Insert Size 656 bp
Sequence Data
>SC208471 3'UTR clone of NM_002160
The sequence shown below is from the reference sequence of NM_002160. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTTGAAGGCAGGCGCAAACGGGCATAAATTCCAGGGACCACTGGGTGAGAGAGGAATAAGGCCCAGAGC
GAGGAAAGGATTTTACCAAAGCATCAATACAACCAGCCCAACCATCGGTCCACACCTGGGCATTTGGTGA
GAGTCAAAGCTGACCATGGATCCCTGGGGCCAACGGCAACAGCATGGGCCTCACCTCCTCTGTGATTTCT
TTCTTTGCACCAAAGACATCAGTCTCCAACATGTTTCTGTTTTGTTGTTTGATTCAGCAAAAATCTCCCA
GTGACAACATCGCAATAGTTTTTTACTTCTCTTAGGTGGCTCTGGGAATGGGAGAGGGGTAGGATGTACA
GGGGTAGTTTGTTTTAGAACCAGCCGTATTTTACATGAAGCTGTATAATTAATTGTCATTATTTTTGTTA
GCAAAGATTAAATGTGTCATTGGAAGCCATCCCTTTTTTTACATTTCATACAACAGAAACCAGAAAAGCA
ATACTGTTTCCATTTTAAGGATATGATTAATATTATTAATATAATAATGATGATGATGATGATGAAAACT
AAGGATTTTTCAAGAGATCTTTCTTTCCAAAACATTTCTGGACAGTACCTGATTGTATTTTTTTTTTAAA
TAAAAGCACAAGTACTTTTGAGTTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002160.2
Summary 'This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]'
Locus ID 3371

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.