CD163 (NM_203416) Human 3' UTR Clone

CAT#: SC208539

3`UTR clone of CD163 molecule (CD163) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CD163"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CD163
Synonyms M130; MM130; SCARI1
ACCN NM_203416
Insert Size 627
Sequence Data
>SC208539 3'UTR clone of NM_203416
The sequence shown below is from the reference sequence of NM_203416. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATTCTGAGCCACACTGAAAAGGAAAATGGGAATTTATAACCCAGTGAGTTCAGCCTTTAAGATACCTT
GATGAAGACCTGGACTATTGAATGGAGCAGAAATTCACCTCTCTCACTGACTATTACAGTTGCATTTTTA
TGGAGTTCTTCTTCTCCTAGGATTCCTAAGACTGCTGCTGAATTTATAAAAATTAAGTTTGTGAATGTGA
CTACTTAGTGGTGTATATGAGACTTTCAAGGGAATTAAATAAATAAATAAGAATGTTATTGATTTGAGTT
TGCTTTAATTACTTGTCCTTAATTCTATTAATTTCTAAATGGGCTTCCTAATTTTTTGTAGAGTTTCCTA
GATGTATTATAATGTGTTTTATTTGACAGTGTTTCAATTTGCATATACAGTACTGTATATTTTTTCTTAT
TTGGTTTGAATAATTTTCCTATTACCAAATAAAAATAAATTTATTTTTACTTTAGTTTTTCTAAGACAGG
AAAAGTTAATGATATTGAAGGGTCTGTAAATAATATATGGCTAACTTTATAAGGCATGACTCACAACGAT
TCTTTAACTGCTTTTTGTTACTGTAATTCTGTTCACTAGAATAAAATGCAGAGCCACACCTGGTGAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203416.2
Summary The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Locus ID 9332

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.