CNTF Receptor alpha (CNTFR) (NM_001842) Human 3' UTR Clone

CAT#: SC208546

3`UTR clone of ciliary neurotrophic factor receptor (CNTFR) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CNTFR
• Synonyms: MGC1774
• ACCN: NM_001842
• Insert Size: 637 bp
• Sequence Data:
  Insert Sequence

  >SC208546 3'UTR clone of NM_001842
  The sequence shown below is from the reference sequence of NM_001842. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCAGTCTCTTGATCTGAGCCCGGCACCCCATGAGGACATGCAGAGCACCTGCAGAGGAGCAGGAGGCCG
  GAGCTGAGCCTGCAGACCCCGGTTTCTATTTTGCACACGGGCAGGAGGACCTTTTGCATTCTCTTCAGAC
  ACAATTTGTGGAGACCCCGGCGGGCCCGGGCCTGCCGCCCCCCAGCCCTGCCGCACCAAGCTGGCCCTCC
  TTCCTCCCTCAGGGGAGGTGGGCCATGCAGCTAACCCACCCACCAAAGACCCCCTCACCCTGGCCCCTTG
  GGCTGGACCCTCCAATGCCAGCGACTCCCAGGAGCCCTTGGGGGACGTGAGGGGAGCCTCTCACATCCGA
  TTTCTCCTCCTGCCCCAGCCTCCTGTCTATCCCAGGGTCTCTGTTGCCACCATCAGATTATAAGCTCCTG
  ATGCTGGGGGGGCCCAGCCATCCCCCTCCCCCCAGCACCCACAATTTTCAGTCCCCTCCCCTCTGCCCTG
  TTTTGTATACCCCTCCCCTGACCCTGCTCCTATCCCACAGTATTTAATGCCCTGTCAGTCCCTTCTAGTC
  TGACTCAATGGTAACTTGCTGTATTTGAATTTTTTATAGATGTATATACAGGGTGGGGGGAGTGGGCGGT
  TCTCATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001842.3
• Summary: 'This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2011]'
• Locus ID: 1271