GADD45B (NM_015675) Human 3' UTR Clone

CAT#: SC208573

3`UTR clone of growth arrest and DNA-damage-inducible beta (GADD45B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GADD45B
• Synonyms: GADD45BETA; MYD118
• ACCN: NM_015675
• Insert Size: 666 bp
• Sequence Data:
  Insert Sequence

  >SC208573 3'UTR clone of NM_015675
  The sequence shown below is from the reference sequence of NM_015675. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCTACATCTCTCTTCAGGAACGCTGAGGCCCTTCCCAGCAGCAGAATCTGTTGAGTTGCTGCCACAAAC
  AAAAAATACAATAAATATTTGAACCCCCTCCCCCCCAGCACAACCCCCCCAAAACAACCCAACCCACGAG
  GACCATCGGGGGCAGAGTCGTTGGAGACTGAAGAGGAAGAGGAGGAGGAGAAGGGGAGTGAGCGGCCGCC
  CCCAGGGCGGAGATCCAGGAGCTGGCGGCCGCCGATCCGATGGAGAAGGGGGGACCCAGGCCAGCAGGAG
  ACAGGACCCCCGAAGCTGAGGCCTTGGGATGGAGCAGAAGCCGGAGTGGCGGGGCACGCTGCCGCCTTCC
  CCATCACGGAGGGTCCAGACTGTCCACTCGGGGGTGGAGTGAGACTGACTGCAAGCCCCACCCTCCTTGA
  GACTGGAGCTGGCGTCTGCATACGAGAGACTTGGTTGAACTTGGTTGGTCCTTGTCTGCACCCTCGACAA
  GACCACACTTTGGGACTTGGGAGCTGGGGCTGAAGTTGCTCTGTACCCATGAACTCCCAGTTTGCGAATT
  ATAGAGACAATCTATTTTGTTACTTGCACTTGTTATTCGAACCACTGAGAGCGAGATGGGAAGCATAGAT
  ATCTATATTTTTATTTCTACTATGAGGGCCTTGTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_015675.2
• Summary: 'This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The genes in this group respond to environmental stresses by mediating activation of the p38/JNK pathway. This activation is mediated via their proteins binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. The function of these genes or their protein products is involved in the regulation of growth and apoptosis. These genes are regulated by different mechanisms, but they are often coordinately expressed and can function cooperatively in inhibiting cell growth. [provided by RefSeq, Jul 2008]'
• Locus ID: 4616