SCN1B (NM_001037) Human 3' UTR Clone

CAT#: SC208746

3`UTR clone of sodium channel voltage-gated type I beta (SCN1B) transcript variant a for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SCN1B
• Synonyms: ATFB13; BRGDA5; EIEE52; GEFSP1
• ACCN: NM_001037
• Insert Size: 672 bp
• Sequence Data:
  Insert Sequence

  >SC208746 3'UTR clone of NM_001037
  The sequence shown below is from the reference sequence of NM_001037. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCAAAGAGAACTGCACGGGCGTCCAGGTGGCCGAATAGCCCTGGCCCTGGGCCCCGCCTCAAGGAAGAG
  CCAGCCGTAATGGGGACTCTCCAGGCACCGCCTGCCCCCAGCGTGGGGGTGGCCACTCCTGGGCCCCAGA
  AAGCCTCAGAGTCCTGCCGACGGAGCCACTGGGGTGGGAGGGGGCAGGGGGCTTGGCTCGCACCCCCACT
  TTCGCCTCCTCCAGCTCCTGCCCCGCCGGCCGCGCACCGCCATGCATGATGGGTAAAGCAATACTGCCGC
  TGCCCCCACCCTGCTTCTGCTGCCTGTTTGGGGAGGGGGGCGGTGAGGTGGGGGCAGCGGCCCCGCACCC
  CTCCTCCTTGCTGATTTGCACACATTGGCCGCTTCAGACACGCACTTCTGGGGCCAGCCCCTCCCCGCCT
  CCTCCCTGCCTGGCGGCAGGGGTCGCGATGATGGGCTGGAGCAGTTTGGGGCAGGGGGTTCTGGGACCCA
  CTCCGACTCCCCCTCCCCGGCATCATTTCCCCTCCCGCTTCCTCCGGCTGGACCTGGGGTCCCCCCTCCC
  TGTAATGCACTCCTGCCCCGGCCCAACCTCGCCCTCTCTCACCAGCCTTGAACTGTGGCCACCTAGAAAG
  GGGCCCATTCAGCCTCGTCTCTTTACAGAAGTAGTTTTGTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001037.4
• Summary: 'Voltage-gated sodium channels are heteromeric proteins that function in the generation and propagation of action potentials in muscle and neuronal cells. They are composed of one alpha and two beta subunits, where the alpha subunit provides channel activity and the beta-1 subunit modulates the kinetics of channel inactivation. This gene encodes a sodium channel beta-1 subunit. Mutations in this gene result in generalized epilepsy with febrile seizures plus, Brugada syndrome 5, and defects in cardiac conduction. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]'
• Locus ID: 6324