IL18BP (NM_001145057) Human 3' UTR Clone

CAT#: SC208854

3`UTR clone of interleukin 18 binding protein (IL18BP) transcript variant G for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IL18BP"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IL18BP
Synonyms IL18BPa
ACCN NM_001145057
Insert Size 686
Sequence Data
>SC208854 3'UTR clone of NM_001145057
The sequence shown below is from the reference sequence of NM_001145057. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCCAGCCACAGCAGTCCACAGCAGCAGGGTTAAGACTCAGCACAGGGCCAGCAGCAGCACAACCTTGACC
AGAGCTTGGGTCCTACCTGTCTACCTGGAGTGAACAGTCCCTGACTGCCTGTAGGCTGCGTGGATGCGCA
ACACACCCCCTCCTTCTCTGCTTTGGGTCCCTTCTCTCACCAAATTCAAACTCCATTCCCACCTACCTAG
AAAATCACAGCCTCCTTATAATGCCTCCTCCTCCTGCCATTCTCTCTCCACCTATCCATTAGCCTTCCTA
ACGTCCTACTCCTCACACTGCTCTACTGCTCAGAAACCACCAAGACTGTTGATGCCTTAGCCTTGCACTC
CAGGGCCCTACCTGCATTTCCCACATGACTTTCTGGAAGCCTCCCAACTATTCTTGCTTTTCCCAGACAG
CTCCCACTCCCATGTCTCTGCTCATTTAGTCCCGTCTTCCTCACCGCCCCAGCAGGGGAACGCTCAAGCC
TGGTTGAAATGCTGCCTCTTCAGTGAAGTCATCCTCTTTCAGCTCTGGCCGCATTCTGCAGACTTCCTAT
CTTCGTGCTGTATGTTTTTTTTTTCCCCCTTCACTCTAATGGACTGTTCCAGGGAAGGGATGGGGGCAGC
AGCTGCTTCGGATCCACACTGTATCTGTGTCATCCCCACATGGGTCCTCATAAAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145057.1
Summary The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Locus ID 10068

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.