NMDAR2A (GRIN2A) (NM_001134408) Human 3' UTR Clone

CAT#: SC208951

3`UTR clone of glutamate receptor ionotropic N-methyl D-aspartate 2A (GRIN2A) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRIN2A
• Synonyms: EPND; FESD; GluN2A; LKS; NMDAR2A; NR2A
• ACCN: NM_001134408
• Insert Size: 679 bp
• Sequence Data:
  Insert Sequence

  >SC208951 3'UTR clone of NM_001134408
  The sequence shown below is from the reference sequence of NM_001134408. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAACACTCGTTGCCATCCCAGGCGGTGAATGACAGCTATCTTCGGTCGTCCTTGAGGTCAACGGCATCG
  TACTGTTCCAGGGACAGTCGGGGCCACAATGATGTGTATATTTCGGAGCATGTTATGCCTTATGCTGCAA
  ATAAGAATAATATGTACTCTACCCCCAGGGTTTTAAATTCCTGCAGCAATAGACGCGTGTACAAGAAAAT
  GCCTAGTATCGAATCTGATGTTTAAAAATCTTCCATTAATGTTTTATCTATAGGGAAATATACGTAATGG
  CCAATGTTCTGGAGGGTAAATGTTGGATGTCCAATAGTGCCCTGCTAAGAGGAAGAAGATGTAGGGAGGT
  ATTTTGTTGTTGTTGTTGTTGGCTCTTTTGCACACGGCTTCATGCCATAATCTTCCACTCAAGGAATCTT
  GTGAGGTGTGTGCTGAGCATGGCAGACACCAGATAGGTGAGTCCTTAACCAAAAATAACTAACTACATAA
  GGGCAAGTCTCCGGGACATGCCTACTGGGTATGTTGGCAATAATGATGCATTGGATGCCAATGGTGATGT
  TATGATTTCCTATATTCCAAATTCCATTAAGGTCAGCCCACCATGTAATTTTCTCATCAGAAATGCCTAA
  TGGTTTCTCTAATACAGAATAAGCAATATGGTGTGCATGTAAACCTGAC
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001134408.1
• Summary: 'This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]'
• Locus ID: 2903