RNase H1 (RNASEH1) (NM_002936) Human 3' UTR Clone

CAT#: SC209018

3`UTR clone of ribonuclease H1 (RNASEH1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNASEH1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RNASEH1
Synonyms H1RNA; PEOB2; RNH1
ACCN NM_002936
Insert Size 715
Sequence Data
>SC209018 3'UTR clone of NM_002936
The sequence shown below is from the reference sequence of NM_002936. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATTAGCCAGAGAAGGAGCTAAACAATCGGAAGACTGAGCCATGTGACTTTAGTCCTTGGGAGAACTTGA
GCCAGCGGCTGTCTTGCTGCCTGTACTTACTGGTGTGGAAAATAGCCTGCAGGTAGGACCATTGCAGTGA
TGGGCAGATGCGTCTTTCACACGGAATCAGGCACAGTGGCCTTCTGTGACATGTGTTTATAAAAAATGGT
TAAGTATATAATAAATTGAACATCTTTGAGATTGGAGAATTATGTGAGATTTCCACATTATGTTTACTGG
GTTCAATACTGTCCTTGCTTGTTTTATTGCAGGCAAGCAAGGCAAATGGCCTAAAATGCTGTGGCTTATA
TTTTGATAAGAAATCAAAAAACCATTGGTTAAAAGATGCAACTCAGAAGTCTGGAAGTATTCTGAAAGCA
TCCATTTACCGTCCAGTTGACAGGTTTGAGTCTCCTGCTTGTATAGGTGACTTGTGCCCATGGGTACATT
AAAGGAACATGCTGCCCAGGGCCTGGGCGGACAGCTCAGTGGGCAGGATGTGTGCTGGGTCTCAGCCCCA
TGTGCCTGCTTGCTGGGCAGTTAGTATAGGGCAAAGCCTGCCTGCGGCGACCCTGGCTGCTAGGCCATTC
TCTAGGAACAGCTGCGACTCATAAAGACCAAGAAGCATAAATAAACTTTCAAAAATTTATTTGGCTCTTT
CGTTAAAAACTGTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002936.3
Summary This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and plays a key role in DNA replication and repair. Alternate in-frame start codon initiation results in the production of alternate isoforms that are directed to the mitochondria or to the nucleus. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF). Mutations in this gene have been found in individuals with progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2. Alternative splicing results in additional coding and non-coding transcript variants. Pseudogenes of this gene have been defined on chromosomes 2 and 17. [provided by RefSeq, Jul 2017]
Locus ID 246243

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.