Nck (NCK1) (NM_006153) Human 3' UTR Clone

CAT#: SC209022

3`UTR clone of NCK adaptor protein 1 (NCK1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NCK1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NCK1
Synonyms NCK; nck-1; NCKalpha
ACCN NM_006153
Insert Size 682 bp
Sequence Data
>SC209022 3'UTR clone of NM_006153
The sequence shown below is from the reference sequence of NM_006153. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATCTTGTCAAGCATTTATCATGATACTGCTGACCAGAAGTGACTGCTGTGTAGCTGTAATTTGTCATGTA
ATTGAAGACTGAGAAAATGTTGGGTCCAGTCGTGCTTGATTGGAAATTGTTGTTTCTAAATCTATATGAG
AATTGACAATAAGTATTTTTATTATAACTCAGCCCATACATATATACTATGTATGCAGTGCATCTGCATA
GAACAGTTCCTTATCCTTGGCCTTCTGTTTTATTGTTTTTTTCTTTGCTGTTTTCCCTTTGCTTCTAATA
TTACAGTTTTGTATTTTGTAAACAAAAATCAAATAATGCATATCAGAATCTTTATATGGAAGAAATCCTT
TATTGCCTTTCCTTTGTTTCCTTGTAAAGGCACCCTGTTCTGTTATGGTTTTTCATTATATAAAATTATT
ATATCTATATATGACATATGCTAAAATTTCTTGGAGAGTGTTAATCTTTTCTGTGACTAAATAGCAATAA
TAAGTGGAAAATTAGAAATTATTTCCAGGTATTATATTTGTCACAGGCCATTGTAAATACCAAGTATATT
GTGTCTGCCATAATTTTTAAAAATACATTCATTGTCTTCAGTCATACAGCAAGACACATGAGACATAGAT
TAGAAAACATGTTGTACAATTTTAATTTACAACTGTTGGAAATAAAAATCAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006153.3
Summary 'The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]'
Locus ID 4690

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.