TRAF6 (NM_004620) Human 3' UTR Clone

CAT#: SC209041

3`UTR clone of TNF receptor-associated factor 6 (TRAF6) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRAF6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TRAF6
Synonyms MGC:3310; RNF85
ACCN NM_004620
Insert Size 700
Sequence Data
>SC209041 3'UTR clone of NM_004620
The sequence shown below is from the reference sequence of NM_004620. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTTTTCAGCCACGAAGTACTGATGCAGGGGTATAGCTTGCCCTCACTTGCTCAAAAACAACTACCTGGA
GAAAACAGTGCCTTTCCTTGCCCTGTTCTCAATAACATGCAAACAAACAAGCCACGGGAAATATGTAATA
TCTACTAGTGAGTGTTGTTAGAGAGGTCACTTACTATTTCTTCCTGTTACAAATGATCTGAGGCAGTTTT
TTCCTGGGAATCCACACGTTCCATGCTTTTTCAGAAATGTTAGGCCTGAAGTGCCTGTGGCATGTTGCAG
CAGCTATTTTGCCAGTTAGTATACCTCTTTGTTGTACTTTCTTGGGCTTTTGCTCTGGTGTATTTTATTG
TCAGAAAGTCCAGACTCAAGAGTACTAAACTTTTAATAATAATGGATTTTCCTTAAAACTTCAGTCTTTT
TGTAGTATTATATGTAATATATTAAAAGTGAAAATCACTACCGCCTTGTGCTAGTGCCCTCGAGAAGAGT
TATTGCTCTAGAAAGTTGAGTTCTCATTTTTTTAACCTGTTATAGATTTCAGAGGATTTGAACCATAATC
CTTGGAAAACTTAAGTTCTCATTCACCCCAGTTTTTCCTCCAGGTTGTTACTAAGGATATTCAGGGATGA
GTTTAAACCCTAAATATAACCTTAATTATTTAGTGTAAACATGTCTGTTGAATAATACTTGTTTAAGTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004620.2
Summary The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported. [provided by RefSeq, Feb 2012]
Locus ID 7189

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.