Caspase-6 (CASP6) (NM_001226) Human 3' UTR Clone

CAT#: SC209069

3`UTR clone of caspase 6 apoptosis-related cysteine peptidase (CASP6) transcript variant alpha for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CASP6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CASP6
Synonyms MCH2
ACCN NM_001226
Insert Size 726 bp
Sequence Data
>SC209069 3'UTR clone of NM_001226
The sequence shown below is from the reference sequence of NM_001226. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAATGCTAACTAAAAAGCTGCATTTCTTTCCAAAATCTAATTAATTAATAGAGGCTATCTAATTTTACAC
TCTGTATTGAAAATGGCTTTCTCAGCCAGGCGTGGTTACTCACACCTGTAATCCCAGCACTTTGGGAGTC
CAAGGTGGGCGGATCACCTGAGGTCGGGAGTTCGAGACCAGCCTGACCAACATGGAGAAGCCCCGTCTCT
ACTAAAAATGCAAAAAAAAATTTAGCTAGGCATGGCGGCGCATGCCTGCAATCCCAGCTACTTGGAAGGC
TGAGGCAGGAGAATCACTTGAACCCAGGAGGTGGAGGCTGCGGTGAGCCGAGATTGCGCCATTGCACTCC
AGCCTGGGCAACGAGTGAAACTCCGTCTCAAAAAAAAGAAAATGTCTTTCTCTTCCTTTTATATAAATAT
CGTTAGGGTGAAGCATTATGGTCTAATGATTCAAATGTTTTAAAGTTTAATGCCTAGCAGAGAACTGCCT
TAAAAAAAAAAAAAAAAAGTTCATGTTGGCCATGGTGAAAGGGTTTGATATGGAGAAACAAAATCCTCAG
GAAATTAGATAAATAAAAATTTATAAGCATTTGTATTATTTTTTAATAAACTGCAGGGTTACACAAAAAT
CTAGCTGATTTAACTTGTATTTTGTCACTTTTTTATAAAAGTTTATTGTTTGATGTTTTTAAAGGTTTTT
GAAATCCAGGAATTAAATCATCCCTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001226.3
Summary 'This gene encodes a member of the cysteine-aspartic acid protease (caspase) family of enzymes. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic acid residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein is processed by caspases 7, 8 and 10, and is thought to function as a downstream enzyme in the caspase activation cascade. Alternative splicing of this gene results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Oct 2015]'
Locus ID 839

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.