HMGB2 (NM_001130689) Human 3' UTR Clone

CAT#: SC209104

3`UTR clone of high-mobility group box 2 (HMGB2) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HMGB2
• Synonyms: HMG2
• ACCN: NM_001130689
• Insert Size: 711 bp
• Sequence Data:
  Insert Sequence

  >SC209104 3'UTR clone of NM_001130689
  The sequence shown below is from the reference sequence of NM_001130689. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGATGAGGAGGAAGAGGATGAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGT
  GTGTGTGCTCAGGCAATTATTTTGCTAAGAATGTGAATTCAAGTGCAGCTCAATACTAGCTTCAGTATAA
  AAACTGTACAGATTTTTGTATAGCTGATAAGATTCTCTGTAGAGAAAATACTTTTAAAAAATGCAGGTTG
  TAGCTTTTTGATGGGCTACTCATACAGTTAGATTTTACAGCTTCTGATGTTGAATGTTCCTAAATATTTA
  ATGGTTTTTTTAATTTCTTGTGTATGGTAGCACAGCAAACTTGTAGGAATTAGTATCAATAGTAAATTTT
  GGGTTTTTTAGGATGTTGCATTTCGTTTTTTTAAAAAAAATTTTGTAATAAAATTATGTATATTATTTCT
  ATTGTCTTTGTCTTAATATGCTAAGTTAATTTTCACTTTAAAAAAGCCATTTGAAGACCAGAGCTATGTT
  GATTTTTTTCGGTATTTCTGCCTAGTAGTTCTTAGACACAGTTGACCTAGTAAAATGTTTGAGAATTAAA
  ACCAAACATGCTCATATTTGCAAAATGTTCTTTAAAAGTTACATGTTGAACTCAGTGAACTTTATAAGAA
  TTTATGCAGTTTTACAGAACGTTAAGTTTTGTACTTGACGTTTCTGTTTATTAGCTAAATTGTTCCTCAG
  GTGTGTGTATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001130689.1
• Summary: 'This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008]'
• Locus ID: 3148