MAD2 (MAD2L1) (NM_002358) Human 3' UTR Clone

CAT#: SC209167

3`UTR clone of MAD2 mitotic arrest deficient-like 1 (yeast) (MAD2L1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAD2L1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MAD2L1
Synonyms HSMAD2; MAD2
ACCN NM_002358
Insert Size 696 bp
Sequence Data
>SC209167 3'UTR clone of NM_002358
The sequence shown below is from the reference sequence of NM_002358. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AATTCCTGTCAATGACTGAGGATGACATGAGGAAAATAATGTAATTGTAATTTTGAAATGTGGTTTTCCT
GAAATCAAGTCATCTATAGTTGATATGTTTTATTTCATTGGTTAATTTTTACATGGAGAAAACCAAAATG
ATACTTACTGAACTGTGTGTAATTGTTCCTTTTATTTTTTTGGTACCTATTTGACTTACCATGGAGTTAA
CATCATGAATTTATTGCACATTGTTCAAAAGGAACCAGGAGGTTTTTTTGTCAACATTGTGATGTATATT
CCTTTGAAGATAGTAACTGTAGATGGAAAAACTTGTGCTATAAAGCTAGATGCTTTCCTAAATCAGATGT
TTTGGTCAAGTAGTTTGACTCAGTATAGGTAGGGAGATATTTAAGTATAAAATACAACAAAGGAAGTCTA
AATATTCAGAATCTTTGTTAAGGTCCTGAAAGTAACTCATAATCTATAAACAATGAAATATTGCTGTATA
GCTCCTTTTGACCTTCATTTCATGTATAGTTTTCCCTATTGAATCAGTTTCCAATTATTTGACTTTAATT
TATGTAACTTGAACCTATGAAGCAATGGATATTTGTACTGTTTAATGTTCTGTGATACAGAACTCTTAAA
AATGTTTTTTCATGTGTTTTATAAAATCAAGTTTTAAGTGAAAGTGAGGAAATAAAGTTAAGTTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002358.3
Summary 'MAD2L1 is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. MAD2L1 is related to the MAD2L2 gene located on chromosome 1. A MAD2 pseudogene has been mapped to chromosome 14. [provided by RefSeq, Jul 2008]'
Locus ID 4085

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.