PKR (EIF2AK2) (NM_001135652) Human 3' UTR Clone

CAT#: SC209229

3`UTR clone of eukaryotic translation initiation factor 2-alpha kinase 2 (EIF2AK2) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EIF2AK2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EIF2AK2
Synonyms EIF2AK1; PKR; PPP1R83; PRKR
ACCN NM_001135652
Insert Size 735 bp
Sequence Data
>SC209229 3'UTR clone of NM_001135652
The sequence shown below is from the reference sequence of NM_001135652. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGTGGAAGAAAAGCCCAGAGAAAAATGAACGACACACATGTTAGAGCCCTTCTGAAAAAGTATCCTGCT
TCTGATATGCAGTTTTCCTTAAATTATCTAAAATCTGCTAGGGAATATCAATAGATATTTACCTTTTATT
TTAATGTTTCCTTTAATTTTTTACTATTTTTACTAATCTTTCTGCAGAAACAGAAAGGTTTTCTTCTTTT
TGCTTCAAAAACATTCTTACATTTTACTTTTTCCTGGCTCATCTCTTTATTCTTTTTTTTTTTTTAAAGA
CAGAGTCTCGCTCTGTTGCCCAGGCTGGAGTGCAATGACACAGTCTTGGCTCACTGCAACTTCTGCCTCT
TGGGTTCAAGTGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGATTACAGGCATGTGCCACCCACCCAAC
TAATTTTTGTGTTTTTAATAAAGACAGGGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTC
AAGTAATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGGATGAGCCACCGCGCCCAGCCTCAT
CTCTTTGTTCTAAAGATGGAAAAACCACCCCCAAATTTTCTTTTTATACTATTAATGAATCAATCAATTC
ATATCTATTTATTAAATTTCTACCGCTTTTAGGCCAAAAAAATGTAAGATCGTTCTCTGCCTCACATAGC
TTACAAGCCAGCTGGAGAAATATGGTACTCATTAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001135652.1
Summary 'The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]'
Locus ID 5610

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.