PHF5A (NM_032758) Human 3' UTR Clone

CAT#: SC209253

3`UTR clone of PHD finger protein 5A (PHF5A) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHF5A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PHF5A
Synonyms bK223H9.2; INI; Rds3; SAP14b; SF3B7; SF3b14b
ACCN NM_032758
Insert Size 726
Sequence Data
>SC209253 3'UTR clone of NM_032758
The sequence shown below is from the reference sequence of NM_032758. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGACCTCTTCTATGAACGCAAAAAATACGGCTTCAAGAAGAGGTGATTGGTGGGTGGCCCCTTCCTCCC
CCCAACATCAGTCTGCTGCAGCTGCCAGAAAACATGCCTACTACTACCAGCAGAAAGGGAGCAGAGCCCA
GAGCATCACCAGGAGTGCCTGCTAGTGTACTGGCAGCTTGCCACCCCCTCCTCTCCCTTCACCCAGACAC
GTGGTAGGGATGGAAAAGGATTCTTCACAGAGCACTCTGGCACACCATATCGGAGAAAACTTGATAGATT
AGTTAATGGTTTTTCTTGAATTCGAGAAGCAAAGATCTGTTCTCCATATTGGTATGTTCTCCCTCAACCA
AGATCTTCTAAAAAGAAATAATATTTTAGTCTTCTGCTTGAGGAACTGACTGTGAAGCGACGCCCAGTGA
AAAACATGTTCTTGCAGCAGCTCTGGTGGCAGCTGTCCTTGAGGAACCTTTGGTGTGTGGTGGGAAGCTA
TCAGAACAAGAAATGTAGGCATTTCCCGTTTTTTTTGGGGGGGGGGTGGGGGGGCAGGGCTCTGCCCTCT
TGAAAGGCATTTACTTGTTTAACACTTGTCCAGCTACAGTGGGGTACAGTAGCTGGCTATTCACAGGCAT
CATCATAGCCCACTAGTCTCATATTATTTTCCTTTTGAGAAATTGGAAACTCTTTCTGTTGCTATTATAT
TAATAAAGTTGGTGTTTATTTTCTGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032758.3
Summary This gene encodes a subunit of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. The protein encoded by this gene contains a PHD-finger-like domain that is flanked by highly basic N- and C-termini. This protein belongs to the PHD-finger superfamily and may act as a chromatin-associated protein. This gene has several pseudogenes on different chromosomes. [provided by RefSeq, Jul 2008]
Locus ID 84844

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.