Perforin (PRF1) (NM_005041) Human 3' UTR Clone

CAT#: SC209307

3`UTR clone of perforin 1 (pore forming protein) (PRF1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRF1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PRF1
Synonyms HPLH2; P1; PFP
ACCN NM_005041
Insert Size 719 bp
Sequence Data
>SC209307 3'UTR clone of NM_005041
The sequence shown below is from the reference sequence of NM_005041. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGCCTCCAGGAAACCGGAGTGGGGCCGTGTGGTGAGAACAGTGAGCTTGGAAAGGACCAGTATGCTTG
GACTGAAGGGGTTCTCACAGTGGGAGCCAGGGCTGTCTTCGTATTCCCATTAGACCAAGCTTGTCCAACC
CGAGGCCCGCATGCGGCCCAGGATGGCTTTGAATGCGGCCCAACGCAAATTCGCAAACTTTCTTAAAACA
TTATGAGTTTCTTTTTGCTATTTTTTTTTTTTTTTTAGCTCATCGGCTATCGTTAGTGCTAGTGGATTTT
ACATGTGGCCCAACACAATTCTTCTTCCAACGTGGCCCAGAGAAGCCAAAAGATTGGATACGCATCAGAC
AGATGGAAAAGGGAGATTCAGACTGTTTTTCAGGGAGGTGGCTGGGTTTACACGCTAATCCCGATTCACC
CTGTCCAAACTGCCTAAGCCCTCCGCCATTCTCAAGCCCTGCAGTCACAGCTACACAGATCACAGCTTCA
GCCAGGAGCTGGGCAGAAGGCCAAGAGGCTGTTCCCACCAGGCTGCTCAGGGCTGGTCTTTTAGGACCCT
TCCCTTGAGCCCTCTATGGTGTGGCAAAGCCTTCATTGCCTTAACTGGAGCCCCATCAGCTCCAGCTGCT
CTGTCTTCTTTGCCCACAATGCTTTGCCCCTGAGACAAATGGAGGCCTGTCCTGACCTGTCTCACCATGT
ACATAGCTTGATAAAGGGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005041.4
Summary 'This gene encodes a protein with structural similarities to complement component C9 that is important in immunity. This protein forms membrane pores that allow the release of granzymes and subsequent cytolysis of target cells. Whether pore formation occurs in the plasma membrane of target cells or in an endosomal membrane inside target cells is subject to debate. Mutations in this gene are associated with a variety of human disease including diabetes, multiple sclerosis, lymphomas, autoimmune lymphoproliferative syndrome (ALPS), aplastic anemia, and familial hemophagocytic lymphohistiocytosis type 2 (FHL2), a rare and lethal autosomal recessive disorder of early childhood. [provided by RefSeq, Aug 2017]'
Locus ID 5551

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.