MCM4 (NM_005914) Human 3' UTR Clone

CAT#: SC209348

3`UTR clone of minichromosome maintenance complex component 4 (MCM4) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MCM4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MCM4
Synonyms CDC21; CDC54; hCdc21; IMD54; NKCD; NKGCD; P1-CDC21
ACCN NM_005914
Insert Size 746 bp
Sequence Data
>SC209348 3'UTR clone of NM_005914
The sequence shown below is from the reference sequence of NM_005914. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTCCTGACAGTGACTGGGAAGACCGTGCGCTTGCTCTGAAGCCTTGTGAGCAAGGAAGGCTCCCTGCATG
TCCTGCTTGCTGCACGCCACATGGGTGTGGTCTGCATCTCAGTTGGCCGCCATCAGTGTAAATAGAGCTT
AAAGTCATGGTTTGGCTGCATAAAAATTTTCTAACTTGGGTTCAATATTTGTAGTGAAGTATCTGTTTTC
ATTTTTTTCACGTTATAAATAAAAATACTATGCTGGCCGGGCGCGGTGGCTCACACCTGTAATCCCAGCA
CTTTGGGAGGCCAATGTGGGTGGATCATGAGGTCAGGAGTTCAAGACCAGCCTAGCCAAGATGGTGAAAC
CCCGTCTCTAGTAAAGATAACAAAAAATTAGCTGGGCTTGATGGCATGCGCCTGTAATCCCAGCTACTCG
GGAGGTTGAGGCAGGAGAATCGCTTAAACCCAGGCGGCAGAGGTTGCAGTGAGCCAAGATCGCGCCACTG
CACTCCAGCCTCAGCAATAGAGTGAGACTGTCTCAAAAAAAAAAAAAAAAAAAAAACCTGCCAATTTTCA
AACATACCGTAGAGATTATTTTCAGGTGCCATTTTATAGTATAGCAGCAGGGCTTTTACTCTGTGTATGC
ACAGATGCAGTCTGGGGCATGGTTTGTGTGCTGGACTTTCTCATGGCCATCATCAGTATGCTTATGGATT
TGATGACAGGCATAGCCTGGGCATATCACCTCATTGGTAAAGGGCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005914.2
Summary 'The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]'
Locus ID 4173

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.