DNA Primase (PRIM2) (NM_000947) Human 3' UTR Clone

CAT#: SC209384

3`UTR clone of primase DNA polypeptide 2 (58kDa) (PRIM2) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRIM2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PRIM2
Synonyms p58; PRIM2A
ACCN NM_000947
Insert Size 710 bp
Sequence Data
>SC209384 3'UTR clone of NM_000947
The sequence shown below is from the reference sequence of NM_000947. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGATATGGAAGGACTAGAAGATTACTTTAGTGAAGATTCTTAGGCAGTTTTATAACCCTTTTTCCTCAAT
AGCCTGTTTCCTGTTTTTAAGATTTTGCCTTTGTTGTTGAAAAAGGGTTTCACTCTGTCACCAAGGCTTA
GTGCAGTGACACAATTACAGCTGATTGCAGCCTTGACCTTCCCAGCTCAAGTGATCCTCCTACCTCAGCC
TCCCAAGTAGTTAGGACCACAGGTGTGCACCTCATATCCAGATAATTTTTTTCAATTTTTTTTTGTAGAG
GTGGGGGGTCTCCCTATGTTGCCCAGGCAGATCTCAGACTCCTGGGCTCAAGCGATCCTCACACCTCAGC
GTCCCAGAGTGCTGGGATTACGGTTGTGAGCCACTGTGCCTGGCCTTTTTTTTTTTTTTTAACCTTTTTG
TTTAACTTCTCTCTTCACTGCATCCCAATCCATCTACAGGCATGCACACTTATTAGGAAAGGAGGTTTGA
GGTAACAACAGAGACTTTCACTATATTTTGCTTTGACAGAAGGAAAGAGGAGGAGTTTCTATTAAAATCT
GTCACTTGAGTGATGTCATTTAAGTCCTATTTTAGGAGATAAAAACAGCTTTGGGGACTGGTTAAAGTCC
CCCAGAAACTACAATAAAGAACAACTTTTGTTTTAACTCTTAATCACTTTGTAATTTTGACTCAATCCTT
TTCTGGACCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000947.2
Summary 'This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]'
Locus ID 5558

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.