UGT1A8 (NM_019076) Human 3' UTR Clone

CAT#: SC209428

3`UTR clone of UDP glucuronosyltransferase 1 family polypeptide A8 (UGT1A8) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "UGT1A8"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol UGT1A8
Synonyms GNT1; hUG-BR1; UDPGT; UDPGT 1-8; UGT-1A; UGT-1H; UGT1; UGT1-01; UGT1-08; UGT1.1; UGT1.8; UGT1A; UGT1A1; UGT1A8S; UGT1H
ACCN NM_019076
Insert Size 738
Sequence Data
>SC209428 3'UTR clone of NM_019076
The sequence shown below is from the reference sequence of NM_019076. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCCCACAAATCCAAGACCCATTGAGAAGTGGGTGGGAAATAAGGTAAAATTTTGAACCATTCCCTAGTC
ATTTCCAAACTTGAAAACAGAATCAGTGTTAAATTCATTTTATTCTTATTAAGGAAATACTTTGCATAAA
TTAATCAGCCCCAGAGTGCTTTAAAAAATTCTCTTAAATAAAAATAATAGACTCGCTAGTCAGTAAAGAT
ATTTGAATATGTATCGTGCCCCCTCTGGTGTCTTTGATCAGGATGACATGTGCCATTTTTCAGAGGACGT
GCAGACAGGCTGGCATTCTAGATTACTTTTCTTACTCTGAAACATGGCCTGTTTGGGAGTGCGGGATTCA
AAGGTGGTCCCACGGCTGCCCCTACTGCAAATGGCAGTTTTAATCTTATCTTTTGGCTTCTGCAGATGGT
TGCAATTGATCCTTAACCAATAATGGTCAGTCCTCATCTCTGTCGTGCTTCATAGGTGCCACCTTGTGTG
TTTAAAGAAGGGAAGCTTTGTACCTTTAGAGTGTAGGTGAAATGAATGAATGGCTTGGAGTGCACTGAGA
ACAGCATATGATTTCTTGCTTTGGGGAAAAAGAATGATGCTATGAAATTGGTGGGTGGTGTATTTGAGAA
GATAATCATTGCTTATGTCAAATGGAGCTGAATTTGATAAAAACCCAAAATACAGCTATGAAGTGCTGGG
CAAGTTTACTTTTTTTCTGATGTTTCCTACAACTAAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_019076.4
Summary This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity with many substrates including coumarins, phenols, anthraquinones, flavones, and some opioids. [provided by RefSeq, Jul 2008]
Locus ID 54576

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.