Annexin VI (ANXA6) (NM_001155) Human 3' UTR Clone

CAT#: SC209452

3`UTR clone of annexin A6 (ANXA6) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ANXA6
• Synonyms: ANX6; CBP68; CPB-II; p68; p70
• ACCN: NM_001155
• Insert Size: 757 bp
• Sequence Data:
  Insert Sequence

  >SC209452 3'UTR clone of NM_001155
  The sequence shown below is from the reference sequence of NM_001155. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTGCTGGCTCTCTGTGGTGGTGAGGACTAGGGCCACAGCTTTGGCGGGCACTTCTGCCAAGAAATGGTTA
  TCAGCACCAGCCGCCATGGCCAAGCCTGATTGTTCCAGCTCCAGAGACTAAGGAAGGGGCAGGGGTGGGG
  GGAGGGGTTGGGTTGGGCTCTTATCTTCAGTGGAGCTTAGGAAACGCTCCCACTCCCACGGGCCATCGAG
  GGCCCAGCACGGCTGAGCGGCTGAAAAACCGTAGCCATAGATCCTGTCCACCTCCACTCCCCTCTGACCC
  TCAGGCTTTCCCAGCTTCCTCCCCTTGCTACAGCCTCTGCCCTGGTTTGGGCTATGTCAGATCCAAAAAC
  ATCCTGAACCTCTGTCTGTAAAATGAGTAGTGTCTGTACTTTGAATGAGGGGGTTGGTGGCAGGGGCCAG
  TTGAATGTGCTGGGCGGGGTGGTGGGAAGGATAGTAAATGTGCTGGGGCAAACTGACAAATCTTCCCATC
  CATTTCACCACCCATCTCCATCCAGGCCGCGCTAGAGTACTGGACCAGGAATTTGGATGCCTGGGTTCAA
  ATCTGCATCTGCCATGCACTTGTTTCTGACCTTAGGCCAGCCCCTTTCCCTCCCTGAGTCTCTATTTTCT
  TATCTACAATGAGACAGTTGGACAAAAAAATCTTGGCTTCCCTTCTAACATTAACTTCCTAAAGTATGCC
  TCCGATTCATTCCCTTGACACTTTTTATTTCTAAGGAAGAAATAAAAAGAGATACAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001155.3
• Summary: 'Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]'
• Locus ID: 309