Annexin VI (ANXA6) (NM_004033) Human 3' UTR Clone

CAT#: SC209453

3`UTR clone of annexin A6 (ANXA6) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANXA6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ANXA6
Synonyms annexin A6; annexin VI; annexin VI (p68); ANX6; calcium-binding protein p68; calelectrin; calphobindin II; CBP68
ACCN NM_004033
Insert Size 757 bp
Sequence Data
>SC209453 3'UTR clone of NM_004033
The sequence shown below is from the reference sequence of NM_004033. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGCTGGCTCTCTGTGGTGGTGAGGACTAGGGCCACAGCTTTGGCGGGCACTTCTGCCAAGAAATGGTTA
TCAGCACCAGCCGCCATGGCCAAGCCTGATTGTTCCAGCTCCAGAGACTAAGGAAGGGGCAGGGGTGGGG
GGAGGGGTTGGGTTGGGCTCTTATCTTCAGTGGAGCTTAGGAAACGCTCCCACTCCCACGGGCCATCGAG
GGCCCAGCACGGCTGAGCGGCTGAAAAACCGTAGCCATAGATCCTGTCCACCTCCACTCCCCTCTGACCC
TCAGGCTTTCCCAGCTTCCTCCCCTTGCTACAGCCTCTGCCCTGGTTTGGGCTATGTCAGATCCAAAAAC
ATCCTGAACCTCTGTCTGTAAAATGAGTAGTGTCTGTACTTTGAATGAGGGGGTTGGTGGCAGGGGCCAG
TTGAATGTGCTGGGCGGGGTGGTGGGAAGGATAGTAAATGTGCTGGGGCAAACTGACAAATCTTCCCATC
CATTTCACCACCCATCTCCATCCAGGCCGCGCTAGAGTACTGGACCAGGAATTTGGATGCCTGGGTTCAA
ATCTGCATCTGCCATGCACTTGTTTCTGACCTTAGGCCAGCCCCTTTCCCTCCCTGAGTCTCTATTTTCT
TATCTACAATGAGACAGTTGGACAAAAAAATCTTGGCTTCCCTTCTAACATTAACTTCCTAAAGTATGCC
TCCGATTCATTCCCTTGACACTTTTTATTTCTAAGGAAGAAATAAAAAGAGATACAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004033.2
Summary 'Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]'
Locus ID 309

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.