PKC gamma (PRKCG) (NM_002739) Human 3' UTR Clone

CAT#: SC209698

3`UTR clone of protein kinase C gamma (PRKCG) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRKCG
• Synonyms: PKC-gamma; PKCC; PKCG; PKCgamma; PKCI(3); SCA14
• ACCN: NM_002739
• Insert Size: 757 bp
• Sequence Data:
  Insert Sequence

  >SC209698 3'UTR clone of NM_002739
  The sequence shown below is from the reference sequence of NM_002739. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGCCTGTGCCCGTCATGTAATCTCACCCGCCGCCACTAGGTGTCCCCAACGTCCCCTCCGCCGTGCCG
  GCGGCAGCCCCACTTCACCCCCAACTTCACCACCCCCTGTCCCATTCTAGATCCTGCACCCCAGCATTCC
  AGCTCTGCCCCCGCGGGTTCTAGACGCCCCTCCCAAGCGTTCCTGGCCTTCTGAACTCCATACAGCCTCT
  ACAGCCGTCCCGCGTTCAAGACTTGAGCGGAGCCCGATATTCTCCCTGACCTTAGCGTTCTGGACTCTGC
  CCCAATCGGGTCCAGAGACCACACCACTAACCATCCCCAACTCCATGGGGTTCGAGACTCCATCTTGGTA
  GTTCTGTGCCTCCCCCCAGACCCCGCCCCTGGGGAAATAGCCTCACGGGGTTGGCTGTTCCAGACTCAGG
  TTCCAGAACAGCCCTCGGCCTCCGAGGCTCCCCGCCTCCACTCTAGTTCTAGATGAGTGGGAGGCGTGCC
  CCCCTCCTCCAGTACGTCCCGCTGCTGTGCTCTGGGGATTTCTGGGATATATGGAGGATTCTTTCCCCAG
  AGGCTCCCAATCAGCTTTTGTTCTAGACTTCCCCATCCCGAAGCCATCACTTCTCCCCGCAGCCCGCCTG
  CCGTGCATGGCTCCTGTCTGGCTCGGACCCACCCCAACTCTCCCCAGTGCCTGCCACTCTCTGGGACTCT
  CCTCCTCCCCTCCTCTTCCCTTAGCCTCTCCCACCCGGCCACAGCTGCTGGAGAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002739.3
• Summary: 'Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]'
• Locus ID: 5582