WNT10B (NM_003394) Human 3' UTR Clone

CAT#: SC209735

3`UTR clone of wingless-type MMTV integration site family member 10B (WNT10B) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "WNT10B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol WNT10B
Synonyms SHFM6; STHAG8; WNT-12
ACCN NM_003394
Insert Size 763 bp
Sequence Data
>SC209735 3'UTR clone of NM_003394
The sequence shown below is from the reference sequence of NM_003394. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGCAAGGTTACAGAGTGGGTGAATGTGTGTAAGTGAGGGTCAGCCTTACCTTGGGGCTGGGGAAGAGGA
CTGTGTGAGAGGGGCGCCTTTTCAGCCCTTTGCTCTGATTTCCTTCCAAGGTCACTCTTGGTCCCTGGAA
GCTTAAAGTATCTACCTGGAAACAGCTTTAGGGGTGGTGGGGGTCAGGTGGACTCTGGGATGTGTAGCCT
TCTCCCCAACAATTGGAGGGTCTTGAGGGGAAGCTGCCACCCCTCTTCTGCTCCTTAGACACCTGAATGG
ACTAAGATGAAATGCACTGTATTGCTCCTCCCACTTCTCAACTCCAGAGCCCCTTTAACCCTGATTCATA
CTCCTTTTGGCTGGGGAGTCCCTATAGTTTCACCACTCCTCTCCCTTGAGGGATAACCCCAGGCACTGTT
TGGAGCCATAAGATCTGTATCTAGAAAGAGATCACCCACTCCTATGTACTATCCCCAAACTCCTTTACTG
CAGCCTGGGCTCCCTCTTGTGGGATAATGGGAGACAGTGGTAGAGAGGTTTTTCTTGGGAAAGAGACAGA
GTGCTGAGGGGCACTCTCCCCTGAATCCTCAGAGAGTTGTCTGTCCAGGCCCTTAGGGAAGTTGTCTCCT
TCCATTCAGATGTTAATGGGGACCCTCCAAAGGAAGGGGTTTTCCCATGACTCTTGGAGCCTCTTTTTCC
TTCTTCAGCAGGAAGGGTGGGAAGGGATAATTTATCATACTGAGACTTGTTCTTGGTTCCTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003394.2
Summary 'The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It may be involved in breast cancer, and its protein signaling is likely a molecular switch that governs adipogenesis. This protein is 96% identical to the mouse Wnt10b protein at the amino acid level. This gene is clustered with another family member, WNT1, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]'
Locus ID 7480

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.