CHMP4B (NM_176812) Human 3' UTR Clone

CAT#: SC210197

3`UTR clone of chromatin modifying protein 4B (CHMP4B) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHMP4B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CHMP4B
Synonyms C20orf178; CHMP4A; CTPP3; CTRCT31; dJ553F4.4; Shax1; SNF7; SNF7-2; Vps32-2; VPS32B
ACCN NM_176812
Insert Size 824
Sequence Data
>SC210197 3'UTR clone of NM_176812
The sequence shown below is from the reference sequence of NM_176812. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAATTGGAGAACTGGGCTGGATCCATGTAATGGGGTCCAGCGCTGGCTGGGCCCAGACAGACTGTGGTG
GCCTGCGCAGCGAGCAGGCGTGTGCGTGTGTGGGGCAGGCAGGATGTGGTGCAGGCAGGTTCCATCGCTT
TCGACTCTCACTCCAAAGCAGTAGGGCCGCGTTGCTGCTCACTCTCTGCATAGCATGGTCTGCACCTGGG
AGATGGGCGGGGGGAGGGGGGCGGGCGGGGTGGGAAGTGCCTGCTGTTTATAATGTTGAATTTCTGTAAA
ATAAACTGTATTTGCAAATCCAACATTGAGCTTCTGGACTACGCTGACTCCACTGCTGAATCCTCAATGG
AAAGGGTCGACTGGTTGCAGTTGAAATGACCTGAAATGTAGCCTCTGTCCTTGTAAGTCAGTTGACTTGC
CGCACATCTCTTTGTGTACTTGTACGGTACTGGCAGAAAAGTCATTTTTCAAAAGCCATAGGCTTTTCCT
TGCCCTTAGCTGTAATAATGCATCTGATTTTGATTTCCTCCAGAGCTGTGTTTCTGTCCATCACCTGTGT
ATTGGCCCTGTGTTTACCACTCTGGCCCACTCCTCACCCCCTTGCTCCCCTGGTCTTCTGGAGTTTGTGA
CATTGATTTGAAATGGATGGTGTTCTCTTGAGAGCAAGTGAGATTGTTAGAATTAAGTTCCAACTATACA
GTTTTCTAACATAGCTATAAGGTCCTTGTTGCTGTTTGTGATAACTGATAGATAACTCATTGGAAACGTG
CATACATTTATATTCAGATGAAATTATGGTTTGCACTGTCTATTAAATATCTCG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_176812.4
Summary This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein (CHMP) protein family. The protein is part of the endosomal sorting complex required for transport (ESCRT) complex III (ESCRT-III), which functions in the sorting of endocytosed cell-surface receptors into multivesicular endosomes. The ESCRT machinery also functions in the final abscisson stage of cytokinesis and in the budding of enveloped viruses such as HIV-1. The three proteins of the CHMP4 subfamily interact with programmed cell death 6 interacting protein (PDCD6IP, also known as ALIX), which also functions in the ESCRT pathway. The CHMP4 proteins assemble into membrane-attached 5-nm filaments that form circular scaffolds and promote or stabilize outward budding. These polymers are proposed to help generate the luminal vesicles of multivesicular bodies. Mutations in this gene result in autosomal dominant posterior polar cataracts. [provided by RefSeq, Oct 2009]
Locus ID 128866

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.