Eph receptor A3 (EPHA3) (NM_182644) Human 3' UTR Clone

CAT#: SC210348

3`UTR clone of EPH receptor A3 (EPHA3) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EPHA3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EPHA3
Synonyms EK4; ETK; ETK1; HEK; HEK4; TYRO4
ACCN NM_182644
Insert Size 850 bp
Sequence Data
>SC210348 3'UTR clone of NM_182644
The sequence shown below is from the reference sequence of NM_182644. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAACTAGTCCAGACTGTATGTATTATTTCAATGCAGTCTAGAGGAGGGGGCAGGGATCTTGCAAAAGATG
TCTGATCGTTTATTCTCACTGTTTCTAAGTTTTAAACAAATGTGATACATTTAAGGTATATTGCTTGGGA
CATTGCAATTTGCAGAGCCCTGTGTCTGTATACAGTATTTGTGTTTGTGTGGGTGTACATTTTGTGTTTC
TTTTTTTCTTGTATGCAAATCAAACATATTCTAATGCCTGAAATGCTTCTGTTTTTTTTTTTTAGCCATA
AATTGCTTTTGAGGAACATTATTTAATATAGTAACACACTTCCAGTGTCTGTCATTTCAGATATTCCAGG
TTCATTGCGTGATTCAATGAACCACAAAAAAGAAACTTGCTGATCCATGAGAATCTTAATTTTGTTTTAA
TCCTTAACACATTCAATAGCATATCACAGAGAGAATAAGGATTTTCTAAAATGTGTTTTATCACTTCATT
CACATTCAGAAGTAATTTGAATAGCCTGTTCCTTTAACCCCAAATTTGGCTAAAATTGGCCTAAAACTGG
CAAACATTTTTCCAGTAACTTTTCTTTTTTTCAAATGAATTTTCTTCATACTTAAAAAAGCCCTTTGCTA
AAATATAATTTTCAAAAAGGTAAAATTATGTCTATGGCACTAATATAAAATGAGTAGAAGTTAATGATTT
TACTTAACTCATTTTTTTCTTTCTTTCTTTTTTTTTTTTTTTTTTTGAGACGGAGTCTTGCTCTGTCACC
CAGGCTGGAGTACAGCAGAGCGATCTCGGCTCACTGCAAGCTCCTGCAAGCTCCGCCTCCTGGCTTCACG
CCATTCTCCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_182644.2
Summary 'This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 2042

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.