Isocitrate dehydrogenase (IDH1) (NM_005896) Human 3' UTR Clone

CAT#: SC210544

3`UTR clone of isocitrate dehydrogenase 1 (NADP+) soluble (IDH1) for miRNA target validation

Reconstitution Protocol

USD 560.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "IDH1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IDH1
Synonyms HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC; PICD
ACCN NM_005896
Insert Size 866 bp
Sequence Data
>SC210544 3'UTR clone of NM_005896
The sequence shown below is from the reference sequence of NM_005896. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTTGGAGAAAACTTGAAGATCAAACTAGCTCAGGCCAAACTTTAAGTTCATACCTGAGCTAAGAAGGATA
ATTGTCTTTTGGTAACTAGGTCTACAGGTTTACATTTTTCTGTGTTACACTCAAGGATAAAGGCAAAATC
AATTTTGTAATTTGTTTAGAAGCCAGAGTTTATCTTTTCTATAAGTTTACAGCCTTTTTCTTATATATAC
AGTTATTGCCACCTTTGTGAACATGGCAAGGGACTTTTTTACAATTTTTATTTTATTTTCTAGTACCAGC
CTAGGAATTCGGTTAGTACTCATTTGTATTCACTGTCACTTTTTCTCATGTTCTAATTATAAATGACCAA
AATCAAGATTGCTCAAAAGGGTAAATGATAGCCACAGTATTGCTCCCTAAAATATGCATAAAGTAGAAAT
TCACTGCCTTCCCCTCCTGTCCATGACCTTGGGCACAGGGAAGTTCTGGTGTCATAGATATCCCGTTTTG
TGAGGTAGAGCTGTGCATTAAACTTGCACATGACTGGAACGAAGTATGAGTGCAACTCAAATGTGTTGAA
GATACTGCAGTCATTTTTGTAAAGACCTTGCTGAATGTTTCCAATAGACTAAATACTGTTTAGGCCGCAG
GAGAGTTTGGAATCCGGAATAAATACTACCTGGAGGTTTGTCCTCTCCATTTTTCTCTTTCTCCTCCTGG
CCTGGCCTGAATATTATACTACTCTAAATAGCATATTTCATCCAAGTGCAATAATGTAAGCTGAATCTTT
TTTGGACTTCTGCTGGCCTGTTTTATTTCTTTTATATAAATGTGATTTCTCAGAAATTGATATTAAACAC
TATCTTATCTTCTCCTGAACTGTTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005896.2
Summary 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]'
Locus ID 3417

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.