CYP1A1 (NM_000499) Human 3' UTR Clone

CAT#: SC211305

3`UTR clone of cytochrome P450 family 1 subfamily A polypeptide 1 (CYP1A1) for miRNA target validation

Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "CYP1A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CYP1A1
Synonyms AHH; AHRR; CP11; CYP1; CYPIA1; P1-450; P450-C; P450DX
ACCN NM_000499
Insert Size 946 bp
Sequence Data
>SC211305 3'UTR clone of NM_000499
The sequence shown below is from the reference sequence of NM_000499. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCACTTCCAAATGCAGCTGCGCTCTTAGGTGCTTGAGAGCCCTGAGGCCTAGACTCTGTCTACCTGGTCT
GGTTGGGCAGCCAGACCAGCAGGCTGGCCTATGTGGTCTAAGGTTCAGCCTGAAACTCATAGACACTGAT
CTGGCTGCAGTTTTGCTATCTGGGCTGTGGGCAAGCCTAAGGGATCCTGCCTGCCCCTACCCTGGACTTG
CCTCTGCACACCCTCCAGAGACAACAGGTAAAACAGGGCCACATAGATGCTGATGGAGCCTTCCCAAGTT
GTGCTTGAGCCAGGAGGCCTGCTAGGGTTAGGAGGTCCTTAGGCCTCTGAGAAGCTCTGAAGAACTCTCT
GGAAGCCCCTGGGCCCAGTACCTAGCTGGCTCTGTGAGGGTGCTGACTGGCTTCAGCAAGTTAGAACTAG
CCAAACCAGGACCCTGTCCAATCTTTGACAATTGGGAGCTGCCAAGAGTGAAGGGAAGAGACAGCCCAGG
ATACTGGCACAGAGGTAGTCTCACTGCTTGAACTAGGCTGAGCAATCTGACCCTATGGGTCTAGGACACA
GTTCCTGGGAACATCACATTCCTCTGCCCTTCCTGCAGGCAGGAACAAACAGGGCTGCCTTCTGGCCTTG
TAAGACCCTTATTGCTGTCCTGGAGGGGCTGGGGACTTGTGTCTGCGGGGATCAGAGCGCACAGGGAGTG
CACATATCCAGGCACCAGGACTAGGGCTGGAGTGAGGGGGGGGTATTTCAATTACCTTCTATTGGTCTCC
CTTCTCTACACTCTTGTAATAAAATGTCTATTTTTAATGTTTGTACACAACAATCCTTCTATTCTAGCCT
GCATTGAGCTTGCATGCTTGCATAAGAGCTTAAGAACCATTGATTTAATGTAATAGGGAAAATTCTAACC
CAGGTATCCAAAAATGTGTAAGAACAACTACCTGAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000499.3
Summary 'This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]'
Locus ID 1543

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.