RPE65 (NM_000329) Human 3' UTR Clone

CAT#: SC211325

3`UTR clone of retinal pigment epithelium-specific protein 65kDa (RPE65) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RPE65"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RPE65
Synonyms BCO3; LCA2; mRPE65; p63; rd12; RP20; sRPE65
ACCN NM_000329
Insert Size 966 bp
Sequence Data
>SC211325 3'UTR clone of NM_000329
The sequence shown below is from the reference sequence of NM_000329. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGTCACCTTTCATGGACTGTTCAAAAAATCTTGAGCATACTCCAGCAAGATATGTTTTTGGTAGCAAAA
CTGAGAAAATCAGCTTCAGGTCTGCAATCAAATTCTGTTCAATTTTAGCCTGCTATATGTCATGGTTTTA
ACTTGCAGATGCGCACAATTTTGCAATGTTTTACAGAAAGCACTGAGTTGAGCAAGCAATTCCTTTATTT
AAAAAAAAAAGTACGTATTTAGATAATCATACTTCCTCTGTGAGACAGGCCATAACTGAAAAACTCTTAA
ATATTTAGCAATCAAATAGGAAATGAATGTGGACTTACTAAATGGCTTTTAATTCCTATTATAAGAGCAT
ATTTTAGGTACCTATCTGCTCCAATTATATTTTTAACATTTAAAAACCAAAGTCCTCTACACTTGATTTA
TATTATATGTGGCTTTGCTGAGTCAAGGAAGTATCATGCAATAAGGCTTAATTACTAAATGTCAAACCAA
ACTTTTTCTCAAACCAGGGACTATCATCTAAGATTAATTACAGTAATTATTTTGCGTATACGTAACTGCT
CAAAGATTATGAATCTTATGAATGTTAACCTTTCCGTTTATTACAAGCAAGTACTATTATTTCTGATTTT
ATAATAAGAAAATCTGTGTTTAATCAACTGAGGCCTCTCAACCAAATAACATCTCAGAGATTAAGTTATA
TATTAAAAGCTTATGTAACATAAAAGCAAGTACATATAGTAGTGACTATATTTAAAAAAACAGCATAAAA
TGCTTAAAAATGTAATATTTACTAAAATCAGATTATGGGATAATGTTGCAGGATTATACTTTATTGCATC
TTTTTTGTTTAATTGTATTTAAGCATTGTGCAATCACTTGGGAAAAATATTAAATTATTAACATTGAGGT
ATTAATACATTTTAAGCCTTTTGTTTTTAAATTTCTTTTCTTCCAGAGATTGTTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000329.2
Summary 'The protein encoded by this gene is a component of the vitamin A visual cycle of the retina which supplies the 11-cis retinal chromophore of the photoreceptors opsin visual pigments. It is a member of the carotenoid cleavage oxygenase superfamily. All members of this superfamily are non-heme iron oxygenases with a seven-bladed propeller fold and oxidatively cleave carotenoid carbon:carbon double bonds. However, the protein encoded by this gene has acquired a divergent function that involves the concerted O-alkyl ester cleavage of its all-trans retinyl ester substrate and all-trans to 11-cis double bond isomerization of the retinyl moiety. As such, it performs the essential enzymatic isomerization step in the synthesis of 11-cis retinal. Mutations in this gene are associated with early-onset severe blinding disorders such as Leber congenital. [provided by RefSeq, Oct 2017]'
Locus ID 6121

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.