Metabotropic Glutamate Receptor 4 (GRM4) (NM_000841) Human 3' UTR Clone

CAT#: SC211486

3`UTR clone of glutamate receptor metabotropic 4 (GRM4) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GRM4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GRM4
Synonyms GPRC1D; mGlu4; MGLUR4
ACCN NM_000841
Insert Size 973 bp
Sequence Data
>SC211486 3'UTR clone of NM_000841
The sequence shown below is from the reference sequence of NM_000841. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGTCACTTACACCAACCATGCAATCTAGCGAGTCCATGGAGCTGAGCAGCAGGAGGAGGAGCCGTGACCC
TGTGGAAGGTGCGTCGGGCCAGGGCCACACCCAAGGGCCCAGCTGTCTTGCCTGCCCGTGGGCACCCACG
GACGTGGCTTGGTGCTGAGGATAGCAGAGCCCCCAGCCATCACTGCTGGCAGCCTGGGCAAACCGGGTGA
GCAACAGGAGGACGAGGGGCCGGGGCGGTGCCAGGCTACCACAAGAACCTGCGTCTTGGACCATTGCCCC
TCCCGGCCCCAAACCACAGGGGCTCAGGTCGTGTGGGCCCCAGTGCTAGATCTCTCCCTCCCTTCGTCTC
TGTCTGTGCTGTTGGCGACCCCTCTGTCTGTCTCCAGCCCTGTCTTTCTGTTCTCTTATCTCTTTGTTTC
ACCTTTTCCCTCTCTGGCGTCCCCGGCTGCTTGTACTCTTGGCCTTTTCTGTGTCTCCTTTCTGGCTCTT
GCCTCCGCCTCTCTCTCTCATCCTCTTTGTCCTCAGCTCCTCCTGCTTTCTTGGGTCCCACCAGTGTCAC
TTTTCTGCCGTTTTCTTTCCTGTTCTCCTCTGCTTCATTCTCGTCCAGCCATTGCTCCCCTCTCCCTGCC
ACCCTTCCCCAGTTCACCAAACCTTACATGTTGCAAAAGAGAAAAAAGGAAAAAAAATCAAAACACAAAA
AAGCCAAAACGAAAACAAATCTCGAGTGTGTTGCCAAGTGCTGCGTCCTCCTGGTGGCCTCTGTGTGTGT
CCCTGTGGCCCGCAGCCTGCCCGCCTGCCCCGCCCATCTGCCGTGTGTCTTGCCCGCCTGCCCCGCCCGT
CTGCCGTCTGTCTTGCCCGCCTGCCCGCCTGCCCCTCCTGCCGACCACACGGAGTTCAGTGCCTGGGTGT
TTGGTGATGGTTATTGACGACAATGTGTAGCGCATGATTGTTTTTATACCAAGAACATTTCTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000841.1
Summary 'L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]'
Locus ID 2914

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.