Rnase4 (NM_201239) Mouse Untagged Clone
CAT#: MC200754
Rnase4 (untagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2, (10ug)
"NM_201239" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rnase4 |
Synonyms | C730049F20Rik; Rab1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC005569 sequence for NM_201239
CAGGAAGGAAGGAGTGAAAAACAAAGCTGCCGCCTCCAGTTCCGGGTCCAGGCACTTTCTAGGTAATGAT GGATCTACAGAGGACTCAGTCCTTGCTTCTGCTCTTGGTGCTGACCCTGCTGGGGTTAGGGCTTGTACAG CCCTCCTATGGCCAGGATCGAATGTACCAACGGTTCCTTCGACAGCATGTGGACCCTCAGGCGACAGGTG GCAATGACAACTACTGCAACGTTATGATGCAGAGACGGAAGATGACTTCTGTCCAGTGCAAACGCTTCAA CACCTTCATCCACGAAGACATCTGGAACATTCGTGGCATCTGTAGTACCACCAATATCCTGTGCAAGAAC GGCCAGATGAACTGTCACGAAGGTGTAGTGAAGGTCACGGACTGCAGAGAGACAGGGAACTCCAAGGCCC CCAACTGTAGATACAGGGCAAGAACCAGCACTAGGCGAGTTGTCATTGCCTGTGAGGGTGACCCAGAGGT CCCAGTGCACTTTGACAGATAGATGCTATCCTGCAGCTGTTACAGCTGATAGTTGACCTCTGAGTCAGTG AGACCAACAATGAGTGGTGGCCCCAGGCTTTGTTTCCTTTGCTCGTGCCTTATACTCACATATATCCAAT ATAACCCATGGTGTTAAGCGCATCCCATCCAAGGGGAGAAAGAAGCCTGTGCTCACAGCACTGATGGCTT GGTTCTCCCAGATTCTATCCCCTGGAACTTATGCATTACATGTATTCAGATAGTATCTCAACGATTATAG AGAGCCTTTTCTGTCCAAGCTGTCTCATTCCAGTCCTCTAACACCCCTTGAGACCAATTCTGCCACTGTA TTTAGAAGCTTTGAGTTAAAGGATTTGATGACCACAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_201239 |
ORF Size | 447 bp |
Insert Size | 447 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC005569, AAH05569 |
RefSeq Size | 893 |
RefSeq ORF | 447 |
Locus ID | 58809 |
Gene Summary | This gene encodes a member of the pancreatic ribonuclease A superfamily. The encoded enzyme is sereted and has unique uridine specificity. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the angiogenin, ribonuclease, RNase A family, 5 gene. Each gene splices to a unique downstream exon that contains its complete coding region. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. [provided by RefSeq, Jun 2009] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201018 | Rnase4 (Myc-DDK-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 |
USD 68.00 |
|
MG201018 | Rnase4 (GFP-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 |
USD 300.00 |
|
MR201018L3 | Lenti ORF clone of Rnase4 (Myc-DDK-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 |
USD 500.00 |
|
MR201018L4 | Lenti ORF clone of Rnase4 (mGFP-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review