Rnase4 (NM_201239) Mouse Untagged Clone

CAT#: MC200754

Rnase4 (untagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2, (10ug)


  "NM_201239" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Rnase4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rnase4
Synonyms C730049F20Rik; Rab1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005569 sequence for NM_201239
CAGGAAGGAAGGAGTGAAAAACAAAGCTGCCGCCTCCAGTTCCGGGTCCAGGCACTTTCTAGGTAATGAT GGATCTACAGAGGACTCAGTCCTTGCTTCTGCTCTTGGTGCTGACCCTGCTGGGGTTAGGGCTTGTACAG CCCTCCTATGGCCAGGATCGAATGTACCAACGGTTCCTTCGACAGCATGTGGACCCTCAGGCGACAGGTG GCAATGACAACTACTGCAACGTTATGATGCAGAGACGGAAGATGACTTCTGTCCAGTGCAAACGCTTCAA CACCTTCATCCACGAAGACATCTGGAACATTCGTGGCATCTGTAGTACCACCAATATCCTGTGCAAGAAC GGCCAGATGAACTGTCACGAAGGTGTAGTGAAGGTCACGGACTGCAGAGAGACAGGGAACTCCAAGGCCC CCAACTGTAGATACAGGGCAAGAACCAGCACTAGGCGAGTTGTCATTGCCTGTGAGGGTGACCCAGAGGT CCCAGTGCACTTTGACAGATAGATGCTATCCTGCAGCTGTTACAGCTGATAGTTGACCTCTGAGTCAGTG AGACCAACAATGAGTGGTGGCCCCAGGCTTTGTTTCCTTTGCTCGTGCCTTATACTCACATATATCCAAT ATAACCCATGGTGTTAAGCGCATCCCATCCAAGGGGAGAAAGAAGCCTGTGCTCACAGCACTGATGGCTT GGTTCTCCCAGATTCTATCCCCTGGAACTTATGCATTACATGTATTCAGATAGTATCTCAACGATTATAG AGAGCCTTTTCTGTCCAAGCTGTCTCATTCCAGTCCTCTAACACCCCTTGAGACCAATTCTGCCACTGTA TTTAGAAGCTTTGAGTTAAAGGATTTGATGACCACAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_201239
ORF Size 447 bp
Insert Size 447
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC005569, AAH05569
RefSeq Size 893
RefSeq ORF 447
Locus ID 58809
Gene Summary This gene encodes a member of the pancreatic ribonuclease A superfamily. The encoded enzyme is sereted and has unique uridine specificity. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the angiogenin, ribonuclease, RNase A family, 5 gene. Each gene splices to a unique downstream exon that contains its complete coding region. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.