Obp2a (NM_153558) Mouse Untagged Clone

CAT#: MC204681

Obp2a (untagged) - Mouse lipocalin 13 (Lcn13), (10ug)


  "NM_153558" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Obp2a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Obp2a
Synonyms BC027556; Lcn13
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027556
GAGCCCAGTGCCTGGAGATGAAGAGCCTGCTCCTCACCATCCTGCTGCTGGGGCTGGTGGCTGTCCTGAA GGCTCAGGAAGCCCCGCCAGATGACCTGGTGGATTACTCTGGGATCTGGTACGCAAAGGCCATGGTACAC AATGGTACCCTACCCAGTCACAAGATACCCAGTATAGTTTTCCCTGTGAGAATAATAGCTCTGGAAGAAG GAGACTTGGAGACCACAGTTGTATTCTGGAACAATGGTCATTGCCGTGAGTTTAAATTCGTGATGAAGAA AACAGAAGAGCCTGGCAAATACACCGCTTTTCATAACACGAAGGTTATTCATGTGGAAAAGACGTCGGTG AATGAGCACTACATTTTCTACTGCGAAGGCCGGCACAATGGGACGTCGTCATTCGGGATGGGAAAGCTCA TGGGGAGAGACTCTGGTGAAAATCCAGAGGCCATGGAAGAATTTAAGAATTTCATAAAGCGCATGAATCT CCGACTGGAAAACATGTTTGTGCCAGAGATCGGAGATAAATGTGTTGAAAGTGACTAGGCAGCTACCCAG GTCTGCAACAGCTGAGCCAGCCTTGCTTCCAACACCAAGCTGGGACATCCCTTCACCACACCTCTCCTGG ACCAAACTTCCCACTGCTTCACCACCACCACCTCAGTACCTGCTCCCCTCTCCCCTGACTCCAAATAAAT CTCTTTAGCAGTGAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_153558
ORF Size 531 bp
Insert Size 531
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC027556, AAH27556
RefSeq Size 738
RefSeq ORF 531
Locus ID 227627
Gene Summary May play a role in male fertility. May act as a retinoid carrier protein within the epididymis. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.