Snrpg (NM_026506) Mouse Untagged Clone

CAT#: MC204692

Snrpg (untagged) - Mouse small nuclear ribonucleoprotein polypeptide G (Snrpg), (10ug)


  "NM_026506" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Snrpg"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Snrpg
Synonyms 2810024K17Rik; AL022803; sm-G; SMG; snRNP-G
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027499
CCGCAGAGGAGTCGCCATGAGCAAAGCCCACCCTCCCGAGCTGAAGAAGTTTATGGACAAGAAGTTATCA TTGAAGTTAAACGGTGGCAGGCATGTCCAAGGAATACTGCGGGGCTTTGATCCCTTTATGAACCTTGTGA TTGACGAGTGTGTGGAGATGGCAACCAGTGGGCAACAGAACAACATTGGCATGGTGGTCATCCGAGGAAA CAGCATCATCATGTTAGAAGCCTTGGAAAGAGTCTGACCTGTGCTCAGCAAGCAGTGTCCACATCCCTCC CCAAAGGCCTGTTTGATTGTGATGTAGAATTAGGTCATGTACATTTTCATATGGAACTTTTTACTAAATA AACTTTTGTGATACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_026506
ORF Size 231 bp
Insert Size 231
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC027499, AAH27499
RefSeq Size 398
RefSeq ORF 231
Locus ID 68011

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.