Snrpg (NM_026506) Mouse Untagged Clone
CAT#: MC204692
Snrpg (untagged) - Mouse small nuclear ribonucleoprotein polypeptide G (Snrpg), (10ug)
"NM_026506" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Snrpg |
Synonyms | 2810024K17Rik; AL022803; sm-G; SMG; snRNP-G |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027499
CCGCAGAGGAGTCGCCATGAGCAAAGCCCACCCTCCCGAGCTGAAGAAGTTTATGGACAAGAAGTTATCA TTGAAGTTAAACGGTGGCAGGCATGTCCAAGGAATACTGCGGGGCTTTGATCCCTTTATGAACCTTGTGA TTGACGAGTGTGTGGAGATGGCAACCAGTGGGCAACAGAACAACATTGGCATGGTGGTCATCCGAGGAAA CAGCATCATCATGTTAGAAGCCTTGGAAAGAGTCTGACCTGTGCTCAGCAAGCAGTGTCCACATCCCTCC CCAAAGGCCTGTTTGATTGTGATGTAGAATTAGGTCATGTACATTTTCATATGGAACTTTTTACTAAATA AACTTTTGTGATACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_026506 |
ORF Size | 231 bp |
Insert Size | 231 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC027499, AAH27499 |
RefSeq Size | 398 |
RefSeq ORF | 231 |
Locus ID | 68011 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR220563 | Snrpg (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein polypeptide G (Snrpg) |
USD 68.00 |
|
MG220563 | Snrpg (GFP-tagged) - Mouse small nuclear ribonucleoprotein polypeptide G (Snrpg), (10ug) |
USD 300.00 |
|
MR220563L3 | Lenti ORF clone of Snrpg (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein polypeptide G (Snrpg) |
USD 500.00 |
|
MR220563L4 | Lenti ORF clone of Snrpg (mGFP-tagged) - Mouse small nuclear ribonucleoprotein polypeptide G (Snrpg) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review