Ghrl (NM_021488) Mouse Untagged Clone

CAT#: MC208061

Ghrl (untagged) - Mouse ghrelin (Ghrl), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ghrl
• Synonyms: 2210006E23Rik; Ghr; m46; MTLRP; MTLRPAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208061 representing NM_021488
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGTCTTCAGGCACCATCTGCAGTTTGCTGCTACTCAGCATGCTCTGGATGGACATGGCCATGGCAG
  GCTCCAGCTTCCTGAGCCCAGAGCACCAGAAAGCCCAGCAGAGAAAGGAATCCAAGAAGCCACCAGCTAA
  ACTGCAGCCACGAGCTCTGGAAGGCTGGCTCCACCCAGAGGACAGAGGACAAGCAGAAGAGACAGAGGAG
  GAGCTGGAGATCAGGTTCAATGCTCCCTTCGATGTTGGCATCAAGCTGTCAGGAGCTCAGTATCAGCAGC
  ATGGCCGGGCCCTGGGGAAGTTTCTTCAGGATATCCTCTGGGAAGAGGTCAAAGAGGCGCCAGCTGACAA
  GTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021488
• ORF Size: 354 bp
• Insert Size: 354
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_021488.4, NP_067463.2
• RefSeq Size: 527
• RefSeq ORF: 354
• Locus ID: 58991
• Gene Summary: This gene encodes a preproprotein that undergoes proteolytic processing to yield two bioactive peptides, ghrelin and obestatin. The hormone ghrelin plays a role in enhancing appetite and has numerous other biological functions that include stimulating the secretion of growth hormone (somatotropin) from the anterior pituitary gland. Obestatin is thought to be a hormone that functions in decreasing appetite. Mice lacking the encoded protein develop normally and exhibit no gross anatomical abnormalities. This gene encodes distinct isoforms, some or all of which may undergo similar proteolytic processing. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).