Ifi27l2a (NM_029803) Mouse Untagged Clone

CAT#: MC208074

Ifi27l2a (untagged) - Mouse interferon, alpha-inducible protein 27 like 2A (Ifi27l2a), (10ug)


  "NM_029803" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ifi27l2a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ifi27l2a
Synonyms 2310061N23Rik; Ifi27; Isg12; Isg12(b1)
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208074 representing NM_029803
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGGGAACACTGTTTGGCTCTGCCATAGGAGGAGCTCTGGCCGTGGCAGGGGCACCTGTGGCCCTGG
CTGCCATGGGCTTCACTGGGACAGGCATTGCAGCTGCCTCCATAGCAGCCAAGATGATGTCTGCTGCAGC
AATTGCCAATGGAGGTGGAGTTGCAGCAGGAAGCCTGGTAGCCACACTCCAATCAGCAGGGGTCCTTGGA
CTCTCCACATCAACAAATGCCATCCTAGGGGCTGCTGGGGCAGCTGTTGGAGCCTTGCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_029803
ORF Size 273 bp
Insert Size 273
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC100588, AAI00589
RefSeq Size 540
RefSeq ORF 273
Locus ID 76933

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.