Csnk2b (NM_009975) Mouse Untagged Clone

CAT#: MC208346

Csnk2b (untagged) - Mouse casein kinase 2, beta polypeptide (Csnk2b), (10ug)


  "NM_009975" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Csnk2b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Csnk2b
Synonyms CK II beta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208346 representing NM_009975
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTAGCTCTGAGGAGGTGTCCTGGATTTCCTGGTTCTGTGGGCTCCGTGGTAATGAATTCTTCTGTG
AGGTGGATGAAGACTACATCCAGGACAAATTTAATCTTACTGGACTCAATGAGCAGGTGCCTCACTATCG
ACAAGCTCTGGACATGATCTTAGACCTGGAACCTGATGAAGAGCTGGAAGACAACCCCAACCAGAGCGAC
TTGATCGAACAGGCAGCTGAGATGCTTTATGGGTTGATCCACGCCCGCTACATCCTCACCAACCGAGGCA
TCGCACAAATGTTGGAAAAGTACCAGCAGGGAGACTTTGGCTACTGTCCTCGTGTATACTGTGAGAACCA
GCCAATGCTTCCTATCGGCCTTTCAGACATCCCAGGCGAGGCCATGGTGAAACTCTACTGCCCCAAGTGC
ATGGACGTGTACACACCCAAGTCCTCCAGACACCACCACACGGACGGCGCATACTTCGGCACTGGTTTCC
CTCACATGCTCTTCATGGTGCATCCAGAGTACCGGCCCAAGCGACCTGCCAACCAGTTTGTACCCAGGCT
CTATGGTTTCAAGATCCATCCAATGGCTTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAAGAGCCCA
GTCAAGACTATTCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009975
ORF Size 648 bp
Insert Size 648
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009975.3, NP_034105.1
RefSeq Size 970
RefSeq ORF 648
Locus ID 13001
Gene Summary This gene encodes the beta subunit of the casein kinase 2 enzyme, which is a heterotetramer comprised of alpha and/or alpha-prime catalytic subunits and two regulatory beta subunits. Casein kinase 2 is involved in the regulation of several cellular processes including gene expression, protein synthesis and cell proliferation. Knockout of this gene in mice leads to embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.