Dclk1 (NM_001195540) Mouse Untagged Clone

CAT#: MC208367

Dclk1 (untagged) - Mouse doublecortin-like kinase 1 (Dclk1), transcript variant 7, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dclk1
• Synonyms: 1700113D08Rik; 2810480F11Rik; AI836758; Click-I; Cpg16; Dcamkl1; Dcl; Dclk; mKIAA0369
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208367 representing NM_001195540
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTAGAGCTCATAGAAGTTAATGGAACCCCTGGTAGTCAGCTCTCTACTCCACGCTCGGGCAAGTCAC
  CAAGTCCATCACCCACCAGCCCAGGAAGCCTGCGGAAGCAGAGGGACCTGTACCGCCCCCTCTCGTCGGA
  TGATTTGGACTCAGTAGGAGACTCAGTGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001195540
• ORF Size: 171 bp
• Insert Size: 171
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001195540.1, NP_001182469.1
• RefSeq Size: 5175
• RefSeq ORF: 171
• Locus ID: 13175
• Gene Summary: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
  Transcript Variant: This variant (7) is produced from the 3' promoter. It shares only one exon with variant 5, and encodes a 56 aa isoform [7, also known as ania-4, or CARP (CaMK-related peptide)], which mainly consists of the serine/proline-rich domain. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.