Defa (NM_007847) Mouse Untagged Clone

CAT#: MC208378

Defa (untagged) - Mouse defensin, alpha, related sequence 2 (Defa-rs2), (10ug)


  "NM_007847" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Defa"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Defa
Synonyms CRS4C; CRS4C-1; CRS4C1d; CRS4C1e; CRS4C1f; CRS4C1g; CRS4C1h; CRS4C1i; CRS4C1j; Defcr-rs2; Defcr-rs3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208378 representing NM_007847
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAAACTTGTCCTCCTCTTTGCCCTTGTCCTGCTTGCATTCCAGGTCCAGGCTGATTCTATCCAAA
ACACAGATGAAGAGACTAAAACTGAGGAGCAGCCAGGGGAAAAGGACCAGGCTGTGTCTGTCTCTTTTGG
AGACCCACAAGGCTCTGCTCTTCAAGATGCAGCCCTAGGATGGGGTCGGCGGTGCCCACAATGCCCTAGA
TGCCCGTCATGCCCATCTTGCCCGAGATGCCCGAGGTGCCCGAGGTGCAAATGCAATCCAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007847
ORF Size 276 bp
Insert Size 276
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_007847.1, NP_031873.1
RefSeq Size 484
RefSeq ORF 276
Locus ID 13222
Gene Summary Apparent precursor of a secreted, cationic, proline- and cysteine-rich peptide that contains Cys-Pro-Xaa repeats. Unlike cryptdin, the proposed mature peptide region lacks the structural motif characteristic of defensins. It may have microbicidal activities. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.