Ins2 (NM_001185084) Mouse Untagged Clone

CAT#: MC208794

Ins2 (untagged) - Mouse insulin II (Ins2), transcript variant 3, (10ug)


  "NM_001185084" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ins2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ins2
Synonyms AA986540; Ins-2; InsII; Mody; Mody4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208794 representing NM_001185084
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCTGTGGATGCGCTTCCTGCCCCTGCTGGCCCTGCTCTTCCTCTGGGAGTCCCACCCCACCCAGG
CTTTTGTCAAGCAGCACCTTTGTGGTTCCCACCTGGTGGAGGCTCTCTACCTGGTGTGTGGGGAGCGTGG
CTTCTTCTACACACCCATGTCCCGCCGTGAAGTGGAGGACCCACAAGTGGCACAACTGGAGCTGGGTGGA
GGCCCGGGAGCAGGTGACCTTCAGACCTTGGCACTGGAGGTGGCCCAGCAGAAGCGTGGCATTGTAGATC
AGTGCTGCACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001185084
ORF Size 333 bp
Insert Size 333
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001185084.2, NP_001172013.1
RefSeq Size 587
RefSeq ORF 333
Locus ID 16334
Gene Summary This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. The encoded precursor protein undergoes proteolytic cleavage to produce a disulfide-linked heterodimeric functional protein that is stored in secretory granules. An increase in blood glucose levels, among others, induces the release of insulin from the secretory granules. Mice deficient in the functional hormone encoded by this gene develop diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1-3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.