Lta (NM_010735) Mouse Untagged Clone

CAT#: MC208904

Lta (untagged) - Mouse lymphotoxin A (Lta), (10ug)


  "NM_010735" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lta
Synonyms hlb382; LT; LT-alpha; LT-[a]; LTalpha; Ltx; LT[a]; TNF-beta; Tnfb; TNFSF1; Tnfsf1b; Tnlg1e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208904 representing NM_010735
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACACTGCTCGGCCGTCTCCACCTCTTGAGGGTGCTTGGCACCCCTCCTGTCTTCCTCCTGGGGCTGC
TGCTGGCCCTGCCTCTAGGGGCCCAGGGACTCTCTGGTGTCCGCTTCTCCGCTGCCAGGACAGCCCATCC
ACTCCCTCAGAAGCACTTGACCCATGGCATCCTGAAACCTGCTGCTCACCTTGTTGGGTACCCCAGCAAG
CAGAACTCACTGCTCTGGAGAGCAAGCACGGATCGTGCCTTTCTCCGACATGGCTTCTCTTTGAGCAACA
ACTCCCTCCTGATCCCCACCAGTGGCCTCTACTTTGTCTACTCCCAGGTGGTTTTCTCTGGAGAAAGCTG
CTCCCCCAGGGCCATTCCCACTCCCATCTACCTGGCACACGAGGTCCAGCTCTTTTCCTCCCAATACCCC
TTCCATGTGCCTCTCCTCAGTGCGCAGAAGTCTGTGTATCCGGGACTTCAAGGACCGTGGGTGCGCTCAA
TGTACCAGGGGGCTGTGTTCCTGCTCAGTAAGGGAGACCAGCTGTCCACCCACACCGACGGCATCTCCCA
TCTACACTTCAGCCCCAGCAGTGTATTCTTTGGAGCCTTTGCACTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010735
ORF Size 609 bp
Insert Size 609
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC099464, AAH99464
RefSeq Size 1423
RefSeq ORF 609
Locus ID 16992
Gene Summary Cytokine that in its homotrimeric form binds to TNFRSF1A/TNFR1, TNFRSF1B/TNFBR and TNFRSF14/HVEM. In its heterotrimeric form with LTB binds to TNFRSF3/LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells in vitro and in vivo. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.