Cmc4 (NM_010839) Mouse Untagged Clone

CAT#: MC208990

Mtcp1 (untagged) - Mouse mature T-cell proliferation 1 (Mtcp1), nuclear gene encoding mitochondrial protein, transcript variant 2, (10ug)


  "NM_010839" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cmc4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cmc4
Synonyms Mtcp1nb; p8MTCP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208990 representing NM_010839
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCACAAAAGGATCCATGCCAGAAACAAGCCTGTGAAATACAAAAATGTTTACAAGCCAACAACTATT
TGGAATCGAAGTGTCAGGCTGTCATCCAAGAACTTCGTAAGTGTTGTGCTCGATATCCCAAAGGAAGATC
TCTTGTCTGCTCAGGATTTGAGAAAGAAGAGGAAGAGAAGTTGGCAATGAAGTCTGGATCCAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010839
ORF Size 207 bp
Insert Size 207
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_010839.6, NP_034969.1
RefSeq Size 1011
RefSeq ORF 207
Locus ID 105886298

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.