Pkia (NM_008862) Mouse Untagged Clone

CAT#: MC209178

Pkia (untagged) - Mouse protein kinase inhibitor, alpha (Pkia), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pkia
• Synonyms: AI415001; PKIalpha
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_008862, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTGATGTGGAAACTACGTATGCAGATTTCATTGCTTCAGGAAGAACAGGTAGAAGAAATGCAATAC
  ATGATATCCTGGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTAAAACTAGCAGGCCTTGATAT
  CAACAAGACAGAAGGTGAAGATGATGGACAGAGAAGCTCCACCGAACAAAGTGGAGAAGCCCAGGGAGAA
  GCAGCCAAGTCTGAAAGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_008862
• ORF Size: 231 bp
• Insert Size: 231
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC048244, AAH48244
• RefSeq Size: 3640
• RefSeq ORF: 231
• Locus ID: 18767
• Gene Summary: Extremely potent competitive inhibitor of cAMP-dependent protein kinase activity, this protein interacts with the catalytic subunit of the enzyme after the cAMP-induced dissociation of its regulatory chains. [UniProtKB/Swiss-Prot Function]