Pla2g5 (NM_011110) Mouse Untagged Clone

CAT#: MC209185

Pla2g5 (untagged) - Mouse phospholipase A2, group V (Pla2g5), transcript variant 2, (10ug)


  "NM_011110" in other vectors (5)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pla2g5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pla2g5
Synonyms PLA2; sPLA2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209185 representing NM_011110
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGGTCTCCTCACACTGGCTTGGTTCCTGGCTTGCAGTGTGCCTGCAGTCCCAGGGGGCTTGCTAG
AACTCAAGTCCATGATTGAGAAGGTGACCAGGAAGAATGCCTTTAAGAACTATGGCTTCTACGGCTGCTA
CTGTGGCTGGGGCGGTCGCGGGACACCCAAGGATGGCACTGATTGGTGCTGTCAGATGCACGACCGTTGT
TATGGGCAACTGGAGGAAAAAGACTGTGCCATTCGGACCCAGTCCTATGACTACAGATACACAAATGGCC
TAGTCATCTGCGAACACGACTCCTTCTGTCCAATGAGGCTCTGTGCCTGTGACCGGAAGCTGGTCTACTG
CCTGCGGAGAAACCTCTGGACTTACAACCCTCTTTACCAGTATTACCCCAACTTCCTCTGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011110
ORF Size 414 bp
Insert Size 414
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_011110.4, NP_035240.3
RefSeq Size 1982
RefSeq ORF 414
Locus ID 18784

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.