Sct (NM_011328) Mouse Untagged Clone

CAT#: MC209359

Sct (untagged) - Mouse secretin (Sct), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Sct
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209359 representing NM_011328
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGCCTCCGCTGCCCACGCCGATGCTACTGCTGTTGCTGCTGCTGCTCTCCAGTTCCGCCGCGCTCC
  CTGCACCTCCCAGGACCCCAAGACACTCAGACGGAATGTTCACCAGCGAGCTCAGCCGCTTGCAGGACAG
  TGCCAGGCTGCAGCGCCTGCTGCAGGGTCTGGTGGGGAAGCGCAGCGAGCAGGACACAGAAAATATCCCA
  GAGAACAGCCTGGCCCGGTCCAAGCCCTTAGAGGACCAGCTCTGCTTGCTGTGGTCGAACACTCAGACCC
  TACAGGACTGGCTTCTGCCCAGGCTGTCCCTGGATGGGTCCCTGTCTCTCTGGCTGCCTCCTGGACCAAG
  GTCTGCTGTTGATCGTTCAGAGTGGACTGAAACAACCAGGCCACCCAGATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011328
• ORF Size: 402 bp
• Insert Size: 402
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_011328.3, NP_035458.1
• RefSeq Size: 518
• RefSeq ORF: 402
• Locus ID: 20287
• Gene Summary: This gene encodes the precursor of a gastrointestinal peptide hormone of the secretin-glucagon family. The encoded protein is secreted as a prohormone that undergoes proteolytic processing to generate a mature peptide hormone. The mature peptide regulates secretion of gastric acid, biocarbonate ions from pancreatic and biliary duct epithelia and water homeostasis in the gastrointestinal system. Mice lacking the encoded protein display decreased survival of neuroprogenitor cells during early postnatal period and impaired long-term potentiation and spatial learning in adulthood. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may be processed in a similar manner to generate the mature peptide hormone. [provided by RefSeq, Jul 2015]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. It encodes a shorter protein (isoform 2), compared to isoform 1.