Ccl25 (NM_009138) Mouse Untagged Clone

CAT#: MC209363

Ccl25 (untagged) - Mouse chemokine (C-C motif) ligand 25 (Ccl25), transcript variant 1, (10ug)


  "NM_009138" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ccl25"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ccl25
Synonyms A130072A22Rik; AI852536; CKb15; Scya25; TECK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209363 representing NM_009138
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAACTGTGGCTTTTTGCCTGCCTGGTTGCCTGTTTTGTTGGGGCCTGGATGCCGGTTGTCCATGCCC
AAGGTGCCTTTGAAGACTGCTGCCTGGGTTACCAGCACAGGATCAAATGGAATGTTCTCCGGCATGCTAG
GAATTATCACCAGCAGGAAGTGAGTGGAAGCTGCAACCTACGTGCTGTGAGATTCTACTTCCGCCAGAAA
GTAGTGTGTGGGAATCCAGAGGACATGAATGTGAAGAGGGCGATGAGAATCTTGACAGCTAGGAAAAGGC
TAGTCCACTGGAAGAGCGCCTCAGACTCTCAGACTGAAAGGAAGAAGTCAAACCATATGAAGTCCAAGGT
GGAGAACCCCAACAGTACAAGCGTGAGGAGTGCCACCCTAGGTCATCCCAGGATGGTGATGATGCCCAGA
AAGACCAACAATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009138
ORF Size 435 bp
Insert Size 435
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009138.3, NP_033164.1
RefSeq Size 1073
RefSeq ORF 435
Locus ID 20300
Gene Summary Potentially involved in T-cell development. Recombinant protein shows chemotactic activity on thymocytes, macrophages, THP-1 cells, and dendritics cells but is inactive on peripheral blood lymphocytes and neutrophils. Binds to CCR9. Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the functional protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.