Tmie (NM_146260) Mouse Untagged Clone

CAT#: MC209463

Tmie (untagged) - Mouse transmembrane inner ear (Tmie), (10ug)


  "NM_146260" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Tmie"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tmie
Synonyms 5131400L21Rik; Mm.87012; sr
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209463 representing NM_146260
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGGGAGGCAGCATGGCTCGGGGCGGCTCTGGGCGCTGGGCGGCGCCGCGCTGGGGGCTTGCCTGG
CGGGTGTCGCCACGCAGCTGGTAGAGCCCAGCACCGCACCGCCAAAGCCCAAGCCGCCCCCACTGACCAA
GGAGACTGTGGTGTTCTGGGACATGCGCCTGTGGCACGTGGTGGGCATCTTTTCGCTCTTCGTGTTGTCC
ATCATCATCACGCTATGCTGTGTCTTCAACTGCCGGGTGCCACGGACGCGGAAGGAGATCGAGGCTCGGT
ATCTACAGCGAAAGGCGGCCAAGATGTACACAGACAAGCTGGAGACTGTGCCTCCCCTTAATGAACTCAC
AGAAATCCCTGGAGAGGACAAGAAGAAAAAGAAGAAGGACAGTGTGGACACAGTGGCTATCAAGGTAGAG
GAGGACGAGAAGAATGAGGCGAAGAAGAAAGGAGAGAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_146260
ORF Size 462 bp
Insert Size 462
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC138840, AAI38841
RefSeq Size 1967
RefSeq ORF 462
Locus ID 20776
Gene Summary Unknown. The protein may play some role in a cellular membrane location. May reside within an internal membrane compartment and function in pathways such as those involved in protein and/or vesicle trafficking. Alternatively, the mature protein may be localized in the plasma membrane and serve as a site of interaction for other molecules through its highly charged C-terminal domain. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.