Cd27 (NM_001042564) Mouse Untagged Clone

CAT#: MC209548

Cd27 (untagged) - Mouse CD27 antigen (Cd27), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cd27
• Synonyms: S152; Tnfrsf7; Tp55
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209548 representing NM_001042564
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCATGGCCACCTCCCTACTGGCTCTGCATGCTGGGGACCTTGGTAGGACTCTCAGCTACCCTAGCCC
  CAAACAGCTGTCCAGACAAACACTACTGGACTGGGGGAGGACTCTGCTGCCGGATGTGTGAGCCAGAGAA
  GCCATCCTGGCCCCTACACAGGCAGCTTCCCAACTCGACTGTCTATAGCCAGCGGTCATCCCATAGACCC
  CTGTGCAGCTCGGACTGCATCCGGATCTTTGTGACCTTCTCCAGCATGTTTCTTATCTTCGTCCTGGGTG
  CAATCTTGTTCTTCCATCAAAGAAGAAACCACGGGCCAAATGAAGACCGGCAGGCAGTGCCTGAAGAGCC
  TTGTCCTTACAGCTGCCCCAGGGAAGAGGAGGGCAGTGCTATCCCTATCCAGGAGGACTACCGGAAACCC
  GAGCCTGCTTTCTACCCTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001042564
• ORF Size: 441 bp
• Insert Size: 441
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001042564.1, NP_001036029.1
• RefSeq Size: 1264
• RefSeq ORF: 441
• Locus ID: 21940
• Gene Summary: Receptor for CD70/CD27L. May play a role in survival of activated T-cells. May play a role in apoptosis through association with SIVA1. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks two alternate in-frame exons in the 5' coding region, compared to variant 1. It encodes isoform b, which is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.