Elane (NM_015779) Mouse Untagged Clone

CAT#: MC209856

Elane (untagged) - Mouse elastase, neutrophil expressed (Elane), (10ug)


  "NM_015779" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Elane"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Elane
Synonyms Ela2; F430011M15Rik; NE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_015779, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTTGGCAGACTATCCAGCCGGACTCTGGCTGCCATGCTACTGGCATTGTTCCTGGGTGGCCCAG
CACTGGCCTCAGAGATTGTTGGTGGCCGGCCGGCCCGGCCCCATGCTTGGCCCTTCATGGCATCCCTGCA
GAGGCGTGGAGGTCATTTCTGTGGTGCCACCCTCATTGCCAGGAACTTCGTCATGTCAGCAGCCCACTGT
GTGAACGGCCTAAATTTCCGGTCAGTGCAGGTAGTGCTGGGAGCCCATGACCTGCGGCGACAGGAGCGCA
CTCGACAGACCTTCTCTGTGCAGCGGATCTTCGAGAATGGCTTTGACCCATCACAACTGCTGAACGACAT
TGTGATTATCCAGCTCAATGGCTCCGCTACCATTAACGCCAACGTGCAGGTGGCCCAGCTGCCTGCCCAG
GGCCAGGGCGTGGGTGACAGAACTCCATGTCTGGCCATGGGCTGGGGCAGGTTGGGCACAAACAGACCAT
CACCCAGTGTGCTACAAGAGCTCAATGTGACAGTGGTGACTAACATGTGCCGCCGTCGTGTGAACGTATG
CACTCTGGTGCCACGTCGGCAGGCAGGCATCTGCTTCGGGGACTCTGGCGGACCCTTGGTCTGTAACAAC
CTTGTCCAAGGCATTGACTCCTTCATCCGAGGAGGCTGTGGATCTGGATTGTACCCAGATGCCTTCGCCC
CTGTGGCTGAGTTTGCAGATTGGATCAATTCCATTATCCGAAGCCATAATGACCACCTTCTTACCCATCC
CAAAGACCGAGAGGGCAGGACCAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_015779
ORF Size 798 bp
Insert Size 798
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC145800, AAI45801
RefSeq Size 905
RefSeq ORF 798
Locus ID 50701
Gene Summary This gene encodes a member of the chymotrypsin-like family of serine protease enzymes that hydrolyzes a broad range of protein substrates including elastin. This gene is expressed by neutrophils where the encoded enzyme is stored in azurophil granules. Upon neutrophil activation, the active enzyme is released into the extracellular mileu. Mice lacking the encoded protein exhibit increased susceptibility to sepsis and death following intraperitoneal infection with Gram negative bacteria. This gene is located adjacent to a related proteinase gene on chromosome 10. [provided by RefSeq, Jul 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.